grep a lot of data in the same file - grep

I want a command that can match all the below criteria in Red Hat:
·number range between 0100xxxx to 0110xxxxx
·And have money over 300
·Status either X or Z
·id contains letter ‘a’
·Error_code starting with 2
number,money,status,error-code,id
010018739,13213,X,300,abcde
010523456,343,Z,500,xcvfe
010743576,563,X,201,fgsa
012095654,300,X,400,gcaz
019432343,300,X,402,dewa
011023324,200,X,206,dea
020023433,100,X,303,a
010832134,300,X,200,a
012244242,433,Z,204,ghfsa

Something like this:
awk -F, '($1>=1000000 && $1<11099999) && $2>300 && ($3 ~ "X" || $3 ~ "Z") && index($5,"a") && index($4,"2")==1' file
It doesn't cater for the status being lower-case (but you didn't ask for that), nor does it cater for there being spaces in front of the status or error code (but you didn't ask for that either).

grep only matches text, awk is much more flexible and should fit your case better. For instance:
awk 'BEGIN {FS=","} $2 > 300 {print;}' < yourfile
Basically this is saying that ',' is the field separator, and then for every line where the second field ($2) is > 300, the action (in this case just print the whole line, which could even be omitted IIRC) is executed.
You can have conditions as complex as you like, with a syntax that is similar to C. I would suggest reading man awk and googling for more complex examples, but you should get the idea.

Related

select only a word that is part of colon

I have a text file using markup language (similar to wikipedia articles)
cat test.txt
This is a sample text having: colon in the text. and there is more [[in single or double: brackets]]. I need to select the first word only.
and second line with no [brackets] colon in it.
I need to select the word "having:" only because that is part of regular text. I tried
grep -v '[*:*]' test.txt
This will correctly avoid the tags, but does not select the expected word.
The square brackets specify a character class, so your regular expression looks for any occurrence of one of the characters * or : (or *, but we said that already, didn't we?)
grep has the option -o to only print the matching text, so something lie
grep -ow '[^[:space:]]*:[^[:space:]]*' file.txt
would extract any text with a colon in it, surrounded by zero or more non-whitespace characters on each side. The -w option adds the condition that the match needs to be between word boundaries.
However, if you want to restrict in which context you want to match the text, you will probably need to switch to a more capable tool than plain grep. For example, you could use sed to preprocess each line to remove any bracketed text, and then look for matches in the remaining text.
sed -e 's/\[.*]//g' -e 's/ [^: ]*$/ /' -e 's/[^: ]* //g' -e 's/ /\n/' file.txt
(This assumes that your sed recognizes \n in the replacement string as a literal newline. There are simple workarounds available if it doesn't, but let's not go there if it's not necessary.)
In brief, we first replace any text between square brackets. (This needs to be improved if your input could contain multiple sequences of square brackets on a line with normal text between them. Your example only shows nested square brackets, but my approach is probably too simple for either case.) Then, we remove any words which don't contain a colon, with a special provision for the last word on the line, and some subsequent cleanup. Finally, we replace any remaining spaces with newlines, and (implicitly) print whatever is left. (This still ends up printing one newline too many, but that is easy to fix up later.)
Alternatively, we could use sed to remove any bracketed expressions, then use grep on the remaining tokens.
sed -e :a -e 's/\[[^][]*\]//' -e ta file.txt |
grep -ow '[^[:space:]]*:[^[:space:]]*'
The :a creates a label a and ta says to jump back to that label and try again if the regex matched. This one also demonstrates how to handle nested and repeated brackets. (I suppose it could be refactored into the previous attempt, so we could avoid the pipe to grep. But outlining different solution models is also useful here, I suppose.)
If you wanted to ensure that there is at least one non-colon character adjacent to the colon, you could do something like
... file.txt |
grep -owE '[^:[:space:]]+:[^[:space:]]*|[^[:space:]]*:[^: [:space:]]+'
where the -E option selects a slightly more modern regex dialect which allows us to use | between alternatives and + for one or more repetitions. (Basic grep in 1969 did not have these features at all; much later, the POSIX standard grafted them on with a slightly wacky syntax which requires you to backslash them to remove the literal meaning and select the metacharacter behavior... but let's not go there.)
Notice also how [^:[:space:]] matches a single character which is not a colon or a whitespace character, where [:space:] is the (slightly arcane) special POSIX named character class which matches any whitespace character (regular space, horizontal tab, vertical tab, possibly Unicode whitespace characters, depending on locale).
Awk easily lets you iterate over the tokens on a line. The requirement to ignore matches within square brackets complicates matters somewhat; you could keep a separate variable to keep track of whether you are inside brackets or not.
awk '{ for(i=1; i<=NF; ++i) {
if($i ~ /\]/) { brackets=0; next }
if($i ~ /\[/) brackets=1;
if(brackets) next;
if($i ~ /:/) print $i }' file.txt
This again hard-codes some perhaps incorrect assumptions about how the brackets can be placed. It will behave unexpectedly if a single token contains a closing square bracket followed by an opening one, and has an oversimplified treatment of nested brackets (the first closing bracket after a series of opening brackets will effectively assume we are no longer inside brackets).
A combined solution using sed and awk:
sed 's/ /\n/g' test.txt | gawk 'i==0 && $0~/:$/{ print $0 }/\[/{ i++} /\]/ {i--}'
sed will change all spaces to a newline
awk (or gawk) will output all lines matching $0~/:$/, as long as i equals zero
The last part of the awk stuff keeps a count of the opening and closing brackets.
Another solution using sed and grep:
sed -r -e 's/\[.*\]+//g' -e 's/ /\n/g' test.txt | grep ':$'
's/\[.*\]+//g' will filter the stuff between brackets
's/ /\n/g' will replace a space with a newline
grep will only find lines ending with :
A third on using only awk:
gawk '{ for (t=1;t<=NF;t++){
if(i==0 && $t~/:$/) print $t;
i=i+gsub(/\[/,"",$t)-gsub(/\]/,"",$t) }}' test.txt
gsub returns the number of replacements.
The variable i is used to count the level of brackets. On every [ it is incremented by 1, and on every ] it is decremented by one. This is done because gsub(/\[/,"",$t) returns the number of replaced characters. When having a token like [[][ the count is increased by (3-1=) 2. When a token has brackets AND a semicolon my code will fail, because the token will match, if it ends with a :, before the count of the brackets.

Counting specific lines that don't contain specific word

Please I have question: I have a file like this
#HWI-ST273:296:C0EFRACXX:2:2101:17125:145325/1
TTAATACACCCAACCAGAAGTTAGCTCCTTCACTTTCAGCTAAATAAAAG
+
8?8A;DDDD;#?++8A?;C;F92+2A#19:1*1?DDDECDE?B4:BDEEI
#BBBB-ST273:296:C0EFRACXX:2:1303:5281:183410/1
TAGCTCCTTCGCTTTCAGCTAAATAAAAGCCCAGTACTTCTTTTTTACCA
+
CCBFFFFFFHHHHJJJJJJJJJIIJJJJJJJJJJJJJJJJJJJIJJJJJI
#HWI-ST273:296:C0EFRACXX:2:1103:16617:140195/1
AAGTTAGCTCCTTCGCTTTCAGCTAAATAAAAGCCCAGTACTTCTTTTTT
+
#C#FF?EDGFDHH#HGHIIGEGIIIIIEDIIGIIIGHHHIIIIIIIIIII
#HWI-ST273:296:C0EFRACXX:2:1207:14316:145263/1
AATACACCCAACCAGAAGTTAGCTCCTTCGCTTTCAGCTAAATAAAAGCC
+
CCCFFFFFHHHHHJJJJJJJIJJJJJJJJJJJJJJJJJJJJJJJJJJJIJ
I
I'm interested just about the line that starts with '#HWI', but I want to count all the lines that are not starting with '#HWI'. In the example shown, the result will be 1 because there's one line that starts with '#BBB'.
To be more clear: I just want to know know the number of the first line of the patterns (that are 4 line that repeated) that are not '#HWI'; I hope I'm clear enough. Please tell me if you need more clarification
With GNU sed, you can use its extended address to print every fourth line, then use grep to count the ones that don't start with #HWI:
sed -n '1~4p' file.fastq | grep -cv '^#HWI'
Otherwise, you can use e.g. Perl
perl -ne 'print if 1 == $. % 4' -- file.fastq | grep -cv '^#HWI'
$. contains the current line number, % is the modulo operator.
But once we're running Perl, we don't need grep anymore:
perl -lne '++$c if 1 == $. % 4; END { print $c }' -- file.fastq
-l removes newlines from input and adds them to output.

Grep words with exact two vowels

I have the following issue, I need to retrieve all words that contains exactly 2 vowels (in any order) from a file. The file only contains one word per line.
My current workaround is:
Grep1: Retrieve words such as earth, over, under, one...
grep -i "^[aeiou][^aeiou]*[aeiou][^aeiou]*$" genesis.words > A.txt
and
Grep2: Retrieve words such as formless, deep, said...
grep -i "^[^aeiou][^aeiou]*[aeiou][^aeiou]*[aeiou][^aeiou]*$" genesis.words > B.txt
the above solution works but when I concatenate both regexs into a single regex then return nothing!
Mother of Grep1 & Grep2: should retrieve everything!
grep -i "^[aeiou][^aeiou]*[aeiou][^aeiou]*$|^[^aeiou][^aeiou]*[aeiou][^aeiou]*[aeiou][^aeiou]*$" genesis.words
I think issue is around my implementation of ^$ in expression but have tried diff versions with no sucess!
Any help will be highly appreciated!
OS is AIX 6100-09-04-1441
You were close. This should work:
grep -i "^[^aeiou]*[aeiou][^aeiou]*[aeiou][^aeiou]*$" genesis.words > A.txt
So it should find all eight possibilities (two vowels identify three nonvowel sequence, each possibly empty; 2^3 is 8):
[ ]I[ ]o[ ]
[ ]e[ ]a[r]
[ ]e[r]a[ ]
[ ]e[l]a[n]
[T]e[ ]a[ ]
[D]e[ ]a[r]
[D]e[w]a[r]
[D]a[w]a[ ]
[H]a[w]a[y]
As for concatenation, | needs escaping. You can use a single anchoring:
^(regexp1\|regexp2)$
Since the * can match 0 times or more you should be able to start the string with [^aeiou]*: try
"^[^aeiou]*[aeiou][^aeiou]*[aeiou][^aeiou]*$"
As for fixing your regex, I think you need to escape the bar as \|, so
grep -i "^[aeiou][^aeiou]*[aeiou][^aeiou]*$\|^[^aeiou][^aeiou]*[aeiou][^aeiou]*[aeiou][^aeiou]*$" genesis.words
If you don't mind Perl, you could use this:
perl -lne '$m=$_; tr/[aeiou]//cd; print $m if length()==2;' /usr/share/dict/words
That says... "save the current line (word) in $m. Delete everything that is not a vowel. Print the original word if there are two things (i.e vowels) left."
Note that I am using the system dictionary as input for my tests.
You could do pretty much the same thing in awk.
If you're able to use an alternative to grep tr with wc works well:
words=/path/to/words.txt
while read -e word ; do
v=$(echo $word | tr -cd 'aeiou' | wc -c)
[[ ! $v -eq "2" ]] || echo $word >> output.txt
done < $words
This reads the original file line by line, counts the vowels & returns results with only 2 to output.txt.

Only output values within a certain range

I run a command that produce lots of lines in my terminal - the lines are floats.
I only want certain numbers to be output as a line in my terminal.
I know that I can pipe the results to egrep:
| egrep "(369|433|375|368)"
if I want only certain values to appear. But is it possible to only have lines that have a value within ± 50 of 350 (for example) to appear?
grep matches against string tokens, so you have to either:
figure out the right string match for the number range you want (e.g., for 300-400, you might do something like grep -E [34].., with appropriate additional context added to the expression and a number of additional .s equal to your floating-point precision)
convert the number strings to actual numbers in whatever programming language you prefer to use and filter them that way
I'd strongly encourage you to take the second option.
I would go with awk here:
./yourProgram | awk '$1>250 && $1<350'
e.g.
echo -e "12.3\n342.678\n287.99999" | awk '$1>250 && $1<350'
342.678
287.99999

reading semi-formatted data

I'm totally new to AWK, however I think this is the best way to solve my problem and a good time to learn AWK.
I am trying to read a large data file that is created by a simulation program. The output is made to be readable by humans, so its formatting isn't very consistent. An example of the output is in this image
http://i.imgur.com/0kf8l.png
I need a way to find a line like "He 2 4686A -2.088 0.0071", by specifying the "He 2 4686A" part and get the following two numbers. The problem is the line "He 2 4686A -2.088 0.0071" can appear anywhere in the table.
I know how to find the entry "He 2 4686A", but I don't know which of the 4 columns it's in. So I don't know how to address the values that follow it.
A command that lets me just read the next two words, or tells me the location of the pattern once a match is found will both help.
/He 2 4686A/ finds the line
Ca A 3970A -0.900 0.1100 He 2 4686A -2.088 0.0071 S 3 18.67m -0.371 0.3721 Ar 4 444.7A -2.124 0.0066
Any help is appreciated.
First step should be to bring what seems to be 4 columns of records into a 1-column format...then its easy with awk because you can then filter for the first 5 fields - like:
echo "He 2 4686A -2.088 0.0071" | \
awk '$1 == "He" && $2 == 2 && $3 == "4686A" {print $4, $5}'
which gives
-2.088 0.0071
So, for me, the only challenge is to transform your data to one-column format...And from the picture that look simple because it seems that the columns have a fixed length which you can count.
Assuming that your column-width is 30 characters (difficult to tell from a picture, beware of tabs) and you data is in input_file, then you could first "cut" the data into 4 columns and then pipe the output to another awk-process
awk '{
print substr($0,1,30)
print substr($0,31,30)
print substr($0,61,30)
print substr($0,91,30)
}' input_file | \
awk '$1 == "He" && $2 == 2 && $3 == "4686A" {print $4, $5}'
If you really just need the next two numbers behind an anchor then I would say the grep-solution from Costa is best for you, however this gives you the possibility to implement further logic...
If you're not dead set on using awk, grep would be the easiest way...
egrep -o "He 2 4686A \-?[0-9.]+ \-?[0-9.]+" output.txt
EDIT: The above would work only if the spacing was done with a whitespace, which doesn't seem to be your case. In order to handle tabs and/or repeating whitespaces...
egrep -o "He[ \t]+2[ \t]+4686A[ \t]+\-?[0-9.]+[ \t]+\-?[0-9.]+" output.txt

Resources