Need a grep command for this task - grep

I have a big txt file and I am looking for seq id that starts with species name "ABS". When I do grep "ABS", I only get the list of ABS but not seq id followed by that word. For example list what I am looking for is like this:
ABS|contig05671,
ABS|contig04453,
ABS|CL5170Contig1,
ABS|contig02526,
But, when I do, grep "ABS" filename.txt, I get the result like this:
ABS,
ABS,
ABS,
ABS,
Any help is greatly appreciated. Thanks in advance.

From man grep:
Context Line Control
-A NUM, --after-context=NUM
Print NUM lines of trailing context after matching lines.
Places a line containing a group separator (--) between
contiguous groups of matches. With the -o or --only-matching
option, this has no effect and a warning is given.
-B NUM, --before-context=NUM
Print NUM lines of leading context before matching lines.
Places a line containing a group separator (--) between
contiguous groups of matches. With the -o or --only-matching
option, this has no effect and a warning is given.
-C NUM, -NUM, --context=NUM
Print NUM lines of output context. Places a line containing a
group separator (--) between contiguous groups of matches. With
the -o or --only-matching option, this has no effect and a
warning is given.
So if you need the matching line and the following one, you do grep -A1 ABS file.txt, and similarly for the preceding line with -B1.
However, if you want to format the results in another way (e.g. put the two lines on one and separate by the pipe character) you need a different tool than grep. grep does searching, whereas you also want editing.

Related

grep for path in process(ps) containing number

I would like to grep for process path which has a variable. Example -
This is one of the proceses running.
/var/www/vhosts/rcsdfg/psd_folr/rcerr-m-deve-udf-172/bin/magt queue:consumers:start customer.import_proditns --single-thread --max-messages=1000
I would like to grep for "psd_folr/rcerr-m-deve-udf-172/bin/magt queue" from the running processes.
The catch is that the number 172 keeps changing, but it will be a 3 digit number only. Please suggest, I tried below but it is not returning any output.
sudo ps axu | grep "psd_folr/rcerr-m-deve-udf-'^[0-9]$'/bin/magt queue"
The most relevant section of your regular expression is -'^[0-9]$'/ which has following problems:
the apostrophes have no syntactical meaning to grep other than read an apostrophe
the caret ^ matches the beginning of a line, but there is no beginning of a line in ps's output at this place
the dollar $ matches the end of a line, but there is no end of a line in ps's output at this place
you want to read 3 digits but [0-9] will only match a single one
Thus, the part of your expression should be modified like this -[0-9]+/ to match any number of digits (+ matches the preceding character any number of times but at least once) or like this -[0-9]{3}/ to match exactly three times ({n} matches the preceding character exactly n times).
If you alter your command, give grep the -E flag so it uses extended regular expressions, otherwise you need to escape the plus or the braces:
sudo ps axu | grep -E "psd_folr/rcerr-m-deve-udf-[0-9]+/bin/magt queue"

Match Lines From Two Lists With Wildcards In One List

I have two lists, one of which contains wildcards (in this case represented by *). I would like to compare the two lists and create an output of those that match, with each wildcard * representing a single character.
For example:
File 1
123456|Jane|Johnson|Pharmacist|janejohnson#gmail.com
09876579|Frank|Roberts|Butcher|frankie1#hotmail.com
092362936|Joe|Jordan|Joiner|joe#joesjoinery.com
928|Bob|Horton|Farmer|bhorton#farmernews.co.uk
File 2
1***6|Jane|Johnson|Pharmacist|janejohnson#gmail.com
09876579|Frank|Roberts|Butcher|f**1#hotmail.com
092362936|Joe|Jordan|J*****|joe#joesjoinery.com
928|Bob|Horton|Farmer|b*****n#f*********.co.uk
Output
092362936|Joe|Jordan|Joiner|joe#joesjoinery.com
928|Bob|Horton|Farmer|bhorton#farmernews.co.uk
Explanation
The first two lines are not considered matches because the number of *s is not equal to the number of characters shown in the first file. The latter two are, so they are added to output.
I have tried to reason out ways to do this in AWK and using Join, but I don't know any way to even start trying to achieve this. Any help would be greatly appreciated.
$ cat tst.awk
NR==FNR {
file1[$0]
next
}
{
# Make every non-* char literal (see https://stackoverflow.com/a/29613573/1745001):
gsub(/[^^*]/,"[&]") # Convert every char X to [X] except ^ and *
gsub(/\^/,"\\^") # Convert every ^ to \^
# Convert every * to .:
gsub(/\*/,".")
# Add line start/end anchors
$0 = "^" $0 "$"
# See if the current file2 line matches any line from file1
# and if so print that line from file1:
for ( line in file1 ) {
if ( line ~ $0 ) {
print line
}
}
}
$ awk -f tst.awk file1 file2
092362936|Joe|Jordan|Joiner|joe#joesjoinery.com
928|Bob|Horton|Farmer|bhorton#farmernews.co.uk
sed 's/\./\\./g; s/\*/./g' file2 | xargs -I{} grep {} file1
Explanation:
I'd take advantage of regular expression matching. To do that, we need to turn every asterisk * into a dot ., which represents any character in regular expressions. As a side effect of enabling regular expressions, we need to escape all special characters, particularly the ., in order for them to be taken literally. In a regular expression, we need to use \. to represent a dot (as opposed to any character).
The first step is perform these substitutions with sed, the second is passing every resulting line as a search pattern to grep, and search file1 for that pattern. The glue that allows to do this is xargs, where a {} is a placeholder representing a single line from the results of the sed command.
Note:
This is not a general, safe solution you can simply copy and paste: you should watch out for any characters, in your file containing the asterisks, that are considered special in grep regular expressions.
Update:
jhnc extends the escaping to any of the following characters: .\^$[], thus accounting for almost all sorts of email addresses. He/she then avoids the use of xargs by employing -f - to pass the results of sed as search expressions to grep:
sed 's/[.\\^$[]/\\&/g; s/[*]/./g' file2 | grep -f - file1
This solution is both more general and more efficient, see comment below.

Why does my grep command output "--" between some lines?

I have a fasta file like the test one here:
>HWI-D00196:168:C66U5ANXX:3:1106:16404:19663 1:N:0:GCCAAT
CCTAGCACCATGATTTAATGTTTCTTTTGTACGTTCTTTCTTTGGAAACTGCACTTGTTGCAACCTTGCAAGCCATATAAACACATTTCAGATATAAGGCT
>HWI-D00196:168:C66U5ANXX:3:1106:16404:19663 2:N:0:GCCAAT
AAAACATAAATTTGAGCTTGACAAAAATTAAAAATGAGCCCAGCCTTATATCTGAAATGTGTTTATATGGCTTGCAAGGTTGCAACAAGTGCAGTTTCCAA
>HWI-D00196:168:C66U5ANXX:4:1304:10466:100132 1:N:0:GCCAAT
ATATTTGAATTATCAGAAATAAACACAAAGAAAACCTAGAACAGATAATTTCTTCCACATTATTGATCAGATACAGATTTCAAGGGTACCGTTGTGAATTG
>HWI-D00196:168:C66U5ANXX:4:1304:10466:100132 2:N:0:GCCAAT
AAACGATTGATAGATCTATTTGCATTATAAAAACATTAAAAAAACAAAATACTGATTAAATGTCGTCTTTCTATTCCACAATTTTATAGATCTCACTGTAT
>HWI-D00196:168:C66U5ANXX:4:1307:12056:64030 1:N:0:GCCAAT
CTTACTTTGCCTCTCTCAGCCAATGTCTCCTGAGTCTAATTTTTTGGAGGCTAAGCTATGAGCTAATGATGGGTTCCATTTGGGGCCAATGCTTCAGCCTG
>HWI-D00196:168:C66U5ANXX:4:1307:12056:64030 2:N:0:GCCAAT
CTATTAGTTCTTATCTTTGCCTGCAAATATAAGACTAGCGCTTGAGTAGCTGACAGAGACAAAGTAAGCTGGAGTGTTTATCACCTGGTCACTCCAATTGT
When i type in a simple grep command like:
grep -B1 "CTT" test.fasta
I get a really strange output in which "--" is sometimes placed on a newline above the grep hit like so:
>HWI-D00196:168:C66U5ANXX:4:1304:10466:100132 2:N:0:GCCAAT
AAACGATTGATAGATCTATTTGCATTATAAAAACATTAAAAAAACAAAATACTGATTAAATGTCGTCTTTCTATTCCACAATTTTATAGATCTCACTGTAT
--
>HWI-D00196:168:C66U5ANXX:4:1307:12056:64030 2:N:0:GCCAAT
CTATTAGTTCTTATCTTTGCCTGCAAATATAAGACTAGCGCTTGAGTAGCTGACAGAGACAAAGTAAGCTGGAGTGTTTATCACCTGGTCACTCCAATTGT
I can't figure out why some fasta entries have this and others don't. I don't get this problem when i remove the -B1. I can remove those lines from my file with a grep -v "--" statement, but I'd really like to understand what's going on here.
You are asking for one line of leading context by using the -B1 option. This means grep will display both the line which matched and the line directly before it. Each match will be separated by -- on a line by itself as shown below:
$ man grep | grep -B1 context
-A num, --after-context=num
Print num lines of trailing context after each match. See also
--
-B num, --before-context=num
Print num lines of leading context before each match. See also
--
-C[num, --context=num]
Print num lines of leading and trailing context surrounding each
--
--context[=num]
Print num lines of leading and trailing context. The default is
The reason you aren't seeing -- between every match is that the context is only displayed above a sequence of consecutive matches. So see the following example:
seq 13 | grep -B1 1
1
--
9
10
11
12
13
The seq command produces all the numbers between 1 and 13. Only the first line and the lines from 10 on contain a 1, so you see the 1 in its own group, then --, then the one line context, then the group of consecutive matching lines.
GREP_COLORS section of the grep manpage says :
Specifies the colors and other attributes used to highlight various > parts of the output. Its value is a colon-separated list
of capabilities that defaults to
ms=01;31:mc=01;31:sl=:cx=:fn=35:ln=32:bn=32:se=36 with the rv and
ne boolean capabilities omitted (i.e., false).
and
se=36 SGR substring for separators that are inserted between
selected line fields (:), between context line fields, (-), and
between groups of adjacent lines when nonzero context is
specified (--). The default is a cyan text foreground over the
terminal's default background.
Consider file sample.txt :
$cat sample.txt
ABBB
AAB
AAB
S
S
S
AABB
ABAA
BAA
CCC
$grep -B2 'AAB' sample.txt
ABBB
AAB
AAB
--
S
S
AABB
Here -- is the way of grep to tell you that AAB before -- and S after -- are not adjacent lines in the actual file.

grep for argument of a latex command

I'm trying to sort out some broken references in a latex file. They are commands such as \cref{ps.1.1}. I would like to grep my file and get only the argument of the command as output, in this case ps.1.1. grep -Po \\\\cref{.*?} my.tex gives me only the command, not the rest of the line, but I'd like to also get rid of the \cref{ and } in the output, so that I could iterate over them.
Here is a Perl one-liner, printing out only the matches, including multiple ones on the same line. It puts out a line per match, even for those on the same line, prepended with their line numbers.
perl -nle 'print "$.: $1" while(/\\cref\{(.*?)\}/g)' file.tex
This may need to and can be modified, depending on the exact output you want.
For example, to print just once for multiple matches on the same line, drop the /g modifier (remove g after the regex). To match multiple patterns, add them to the regex (separated by | and grouped by ()) and add $2, $3 (...) to print. To see the whole line, change $1 to $_. Etc.
A simple script would offer far more flexiblity and processing opportunities.

extract a line from a file using csh

I am writing a csh script that will extract a line from a file xyz.
the xyz file contains a no. of lines of code and the line in which I am interested appears after 2-3 lines of the file.
I tried the following code
set product1 = `grep -e '<product_version_info.*/>' xyz`
I want it to be in a way so that as the script find out that line it should save that line in some variable as a string & terminate reading the file immediately ie. it should not read furthermore aftr extracting the line.
Please help !!
grep has an -m or --max-count flag that tells it to stop after a specified number of matches. Hopefully your version of grep supports it.
set product1 = `grep -m 1 -e '<product_version_info.*/>' xyz`
From the man page linked above:
-m NUM, --max-count=NUM
Stop reading a file after NUM matching lines. If the input is
standard input from a regular file, and NUM matching lines are
output, grep ensures that the standard input is positioned to
just after the last matching line before exiting, regardless of
the presence of trailing context lines. This enables a calling
process to resume a search. When grep stops after NUM matching
lines, it outputs any trailing context lines. When the -c or
--count option is also used, grep does not output a count
greater than NUM. When the -v or --invert-match option is also
used, grep stops after outputting NUM non-matching lines.
As an alternative, you can always the command below to just check the first few lines (since it always occurs in the first 2-3 lines):
set product1 = `head -3 xyz | grep -e '<product_version_info.*/>'`
I think you're asking to return the first matching line in the file. If so, one solution is to pipe the grep result to head
set product1 = `grep -e '<product_version_info.*/>' xyz | head -1`

Resources