I am using LaTeX and I have a problem concerning string manipulation.
I want to have an operation applied to every character of a string, specifically
I want to replace every character "x" with "\discretionary{}{}{}x". I want to do
this because I have a long string (DNA) which I want to be able to separate at
any point without hyphenation.
Thus I would like to have a command called "myDNA" that will do this for me instead of
inserting manually \discretionary{}{}{} after every character.
Is this possible? I have looked around the web and there wasnt much helpful
information on this topic (at least not any I could understand) and I hoped
that you could help.
--edit
To clarify:
What I want to see in the finished document is something like this:
the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA
AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG
ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT
ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT
CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC
CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT
AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT
just plain linebreaks, without any hyphens. The DNA sequence will be one
long string without any spaces or anything but it can break at any point.
This is why my idea was to inesert a "\discretionary{}{}{}" after every
character, so that it can break at any point without inserting any hyphens.
This takes a string as an argument and calls \discretionary{}{}{} after each character. The input string stops at the first dollar sign, so you should not use that.
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\say{#1}\discretionary{}{}{}%
\takeTheRest#2\ofTheString
\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\say#1{#1}
You’d call it like \hyphenateWholeString{CTAAAGAAAACAGGACG}.
Instead of \discretionary{}{}{} you can also try \hspace{0pt}, if you like that more (and are in a latex environment). In order to align the right margin, I think you’d need to do some more fine tuning (but see below). The effect is of course minimised by using a font of fixed width.
Revision:
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString\unskip}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\transform{#1}%
\takeTheRest#2\ofTheString\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\transform#1{#1\hskip 0pt plus 1pt}
Steve’s suggestion of using \hskip sounds like a very good idea to me, so I made a few corrections. Note that I’ve renamed the \say macro and made it more useful in that it now actually does the transformation. (However, if you remove the \hskip from \transform, you’ll also need to remove the \unskip in the main macro definition.
Edit:
There is also the seqsplit package which seems to be made for printing DNA data or long numbers. They also bring a few options for nicer output, so maybe that is what you’re looking for…
Debilski's post is definitely a solid way to do it, although the \say is not necessary. Here's a shorter way that makes use of some LaTeX internal shortcuts (\#gobble and \#ifnextchar):
\makeatletter
\def\hyphenatestring#1{\xHyphen#te#1$\unskip}
\def\xHyphen#te{\#ifnextchar${\#gobble}{\sw#p{\hskip 0pt plus 1pt\xHyphen#te}}}
\def\sw#p#1#2{#2#1}
\makeatother
Note the use of \hskip 0pt plus 1pt instead of \discretionary - when I tried your example I ended up with a ragged margin because there's no stretchability. The \hskip adds some stretchable glue in between each character (and the \unskip afterwards cancels the extra one we added). Also note the LaTeX style convention that "end user" macros are all lowercase, while internal macros have an # in them somewhere so that users don't accidentally call them.
If you want to figure out how this works, \#gobble just eats whatever's in front of it (in this case the $, since that branch is only run when a $ is the next char). The main point is that \sw#p is only given one argument in the "else" branch, so it swaps that argument with the next char (that isn't a $). We could just as well have written \def\hyphenate#next#1{#1\hskip...\xHyphen#te} and put that with no args in the "else" branch, but (in my opinion) \sw#p is more general (and I'm surprised it's not in standard LaTeX already).
There is a contrib package on CTAN that deals with typesetting DNA sequences. It does a little more than just line-breaking, for example, it also supports colouring. I'm not sure if it is possible to get the output you are after though, and I have no experience in the DNA-sequence-typesetting area, but is one long string the most readable representation?
Assuming your string is the same, in your preamble, use the \newcommand{}{}. Like this:
\newcommand{\myDNA}{blah blah blah}
if that doesn't satisfy your requirements, I suggest:
2. Break the strings down to the smallest portion, then use the \newcommand and then call the new commands in sequence: \myDNA1 \myDNA2.
If that still doesn't work, you might want to look at writing a perl script to satisfy your string replacement needs.
Related
I know one of LaTeX's bragging points is that it doesn't have this Microsoftish behavior. Nevertheless, it's sometimes useful.
LaTeX already adds an extra space after you type a (non-backslashed) period, so it should be possible to make it automatically capitalize the following letter as well.
Is there an obvious way to write a macro that does this, or is there a LaTeX package that does it already?
The following code solves the problem.
\let\period.
\catcode`\.\active
\def\uppercasesingleletter#1{\uppercase{#1}}
\def.{\period\afterassignment\periodx\let\next= }
\def \periodx{\ifcat\space\next \next\expandafter\uppercasesingleletter \else\expandafter\next\fi}
First. second.third. relax.relax. up
\let\period. save period
\catcode\.\active make all periods to be active symbol (like macro).
\def\uppercasesingleletter#1{\uppercase{#1}} defines macro \uppercasesingleletter to make automatically capitalize the following letter.
\def.{\period\afterassignment\periodx\let\next= } writes saved period and checkes the next symbol.
\def \periodx{\ifcat\space\next \next\expandafter\uppercasesingleletter \else\expandafter\next\fi} If the next letter is a space then \uppercasesingleletter is inserted.
ages ago there was discussion of this idea on comp.text.tex, and the general conclusion was you can't do it satisfactorily. satisfactory, in my book, involves not making characters active, but i can't see how that could work at all.
personally, i would want to make space active, and have it then look at \spacefactor and \MakeUppercase the following character if the factor is 3000.
something like
\catcode\ \active % latex already has a saved space character -- \space
\def {\ifhmode% \spacefactor is invalid
% (or something) in vertical mode
\ifnum\spacefactor<3000\else% note: with space active,
% even cs-ended lines need %-termination
\expandafter\gobbleandupper\fi}%
\def\gobbleandupper#1{\def\tempa{#1}\def\tempb{ }%
\ifx\tempa\tempb% can''t indent the code, either :-(
% here, we have another space
\expandafter\gobbleandupper% try again
\else\space% insert a "real" space to soak up the
% space factor
\expandafter\MakeUppercase\fi}%
this doesn't really do the job -- there are enough loose ends to knit a fairisle jumper. for example, given that we can't rely on \everypar in latex, how do you uppercase the first letter of a paragraph?
no ... however much it hurts (which is why i avoid unnecessary key operations) we need to type latex "properly" :-(
I decided to solve it in the following way:
Since I always compile the LaTeX code three times before i okular the result (to get pagination and references right), I decided to build the capitalization of sentences into that process.
Thus, I now have a shell script that calls my capitalization script (written in CRM114) first, then pdflatex three times, and then okular. This way, all the stuff happens as the result of a single command.
Is it possible to have a TeX command which will take the whole next word (or the next letters up to but not including the next punctuation symbol) as an argument and not only the next letter or {} group?
I’d like to have a \caps command on certain acronyms but don’t want to type curly brackets over and over.
First of all create your command, for example
\def\capsimpl#1{{\sc #1}}% Your main macro
The solution to catch a space or punctuation:
\catcode`\#=11
\def\addtopunct#1{\expandafter\let\csname punct#\meaning#1\endcsname\let}
\addtopunct{ }
\addtopunct{.} \addtopunct{,} \addtopunct{?}
\addtopunct{!} \addtopunct{;} \addtopunct{:}
\newtoks\capsarg
\def\caps{\capsarg{}\futurelet\punctlet\capsx}
\def\capsx{\expandafter\ifx\csname punct#\meaning\punctlet\endcsname\let
\expandafter\capsend
\else \expandafter\continuecaps\fi}
\def\capsend{\expandafter\capsimpl\expandafter{\the\capsarg}}
\def\continuecaps#1{\capsarg=\expandafter{\the\capsarg#1}\futurelet\punctlet\capsx}
\catcode`\#=12
#Debilski - I wrote something similar to your active * code for the acronyms in my thesis. I activated < and then \def<#1> to print the acronym, as well as the expansion if it's the first time it's encountered. I also went a bit off the deep end by allowing defining the expansions in-line and using the .aux files to send the expansions "back in time" if they're used before they're declared, or to report errors if an acronym is never declared.
Overall, it seemed like it would be a good idea at the time - I rarely needed < to be catcode 12 in my actual text (since all my macros were in a separate .sty file), and I made it behave in math mode, so I couldn't foresee any difficulties. But boy was it brittle... I don't know how many times I accidentally broke my build by changing something seemingly unrelated. So all that to say, be very careful activating characters that are even remotely commonly-used.
On the other hand, with XeTeX and higher unicode characters, it's probably a lot safer, and there are generally easy ways to type these extra characters, such as making a multi (or compose) key (I usually map either numlock or one of the windows keys to this), so that e.g. multi-!-! produces ¡). Or if you're running in emacs, you can use C-\ to switch into TeX input mode briefly to insert unicode by typing the TeX command for it (though this is a pain for actually typing TeX documents, since it intercepts your actual \'s, and please please don't try defining your own escape character!)
Regarding whitespace after commands: see package xspace, and TeX FAQ item Commands gobble following space.
Now why this is very difficult: as you noted yourself, things like that can only be done by changing catcodes, it seems. Catcodes are assigned to characters when TeX reads them, and TeX reads one line at a time, so you can not do anything with other spaces on the same line, IMHO. There might be a way around this, but I do not see it.
Dangerous code below!
This code will do what you want only at the end of the line, so if what you want is more "fluent" typing without brackets, but you are willing to hit 'return' after each acronym (and not run any auto-indent later), you can use this:
\def\caps{\begingroup\catcode`^^20 =11\mcaps}
\def\mcaps#1{\def\next##1 {\sc #1##1\catcode`^^20 =10\endgroup\ }\next}
One solution might be setting another character as active and using this one for escaping. This does not remove the need for a closing character but avoids typing the \caps macro, thus making it overall easier to type.
Therefore under very special circumstances, the following works.
\catcode`\*=\active
\def*#1*{\textsc{\MakeTextLowercase{#1}}}
Now follows an *Acronym*.
Unfortunately, this makes uses of \section*{} impossible without additional macro definitions.
In Xetex, it seems to be possible to exploit unicode characters for this, so one could define
\catcode`\•=\active
\def•#1•{\textsc{\MakeTextLowercase{#1}}}
Now follows an •Acronym•.
Which should reduce the effects on other commands but of course needs to have the character ‘•’ mapped to the keyboard somewhere to be of use.
It seems to be common practice, when writing mathematics, to add punctuation to displayed formulas.
Is there any trick to avoid putting the punctuation mark inside the formula?
I want to avoid
Consider the function
\[ \sin(x).\]
I'd rather have something like:
Consider the function
\[ \sin(x)\].
But of course the full stop is displayed below the formula.
Is there a clever way to separate formulas and punctuation in LaTeX?
\catcode`\#=11
\let\seveendformula\]
\def\]{\#ifnextchar.\PointAndEndFormula\seveendformula}
\def \PointAndEndFormula #1{.\seveendformula}
\catcode`\#=12
Add
More complex solution works with .,?!;: :
\catcode`\#=11
\def\addtopunct#1{\expandafter\let\csname punct#\meaning#1\endcsname\let}
\addtopunct{.} \addtopunct{,} \addtopunct{?}
\addtopunct{!} \addtopunct{;} \addtopunct{:}
\let\seveendformula\]
\def\PunctAndEndFormula #1{#1\seveendformula}
\def\]{\futurelet\punctlet\checkpunct#i}
\def\checkpunct#i{\expandafter\ifx\csname punct#\meaning\punctlet\endcsname\let
\expandafter\PunctAndEndFormula
\else \expandafter\seveendformula\fi}
\catcode`\#=12
There's also the issue of which font the punctuation should be in. You won't see a problem until you try a different math font such as Euler. Then commas and periods are clearly different in text mode and in math mode. I've written text-mode punctuation in displayed formulas as \mbox{,} or lazily as \mbox, just before $$.
You can load the breqn package (compatible with amsmath) and have this behaviour inbuilt with its dmath environment:
Consider the function
\begin{dmath}\sin(x)\end{dmath}.
Will output the same as \[\sin(x).\], i.e., as if the dot was inside the expression.
As a bonus, you'll also get automatic line-breaking in your math equation.
Putting the punctuation inside a display environment is the usual way. The problem is that when Latex processes the \], it ends the mathbox, so anything following will be part of a new vertical box.
You could try something like:
\hbox{\[My formula\]}.
This is not tested, and probably has spacing issues, but if you are interested in this kind of solution, I could try and get something working.
FWIW, you might be interested in https://mathoverflow.net/questions/6675/periods-and-commas-in-mathematical-writing
How can I prevent LaTeX from inserting linebreaks in my \texttt{...} or \url{...} text regions? There's no spaces inside I can replace with ~, it's just breaking on symbols.
Update: I don't want to cause line overflows, I'd just rather LaTeX insert linebreaks before these regions rather than inside them.
\mbox is the simplest answer. Regarding the update:
TeX prefers overlong lines to adding too much space between words on a line; I think the idea is that you will notice the lines that extend into the margin (and the black boxes it inserts after such lines), and will have a chance to revise the contents, whereas if there was too much space, you might not notice it.
Use \sloppy or \begin{sloppypar}...\end{sloppypar} to adjust this behavior, at least a little. Another possibility is \raggedright (or \begin{raggedright}...\end{raggedright}).
Surround it with an \mbox{}
Also, if you have two subsequent words in regular text and you want to avoid a line break between them, you can use the ~ character.
For example:
As we can see in Fig.~\ref{BlaBla}, there is nothing interesting to see. A~better place..
This can ensure that you don't have a line starting with a figure number (without the Fig. part) or with an uppercase A.
Use \nolinebreak
\nolinebreak[number]
The \nolinebreak command prevents LaTeX from
breaking the current line at the point of the command. With the
optional argument, number, you can convert the \nolinebreak command
from a demand to a request. The number must be a number from 0 to 4.
The higher the number, the more insistent the request is.
Source: http://www.personal.ceu.hu/tex/breaking.htm#nolinebreak
Define myurl command:
\def\myurl{\hfil\penalty 100 \hfilneg \hbox}
I don't want to cause line overflows,
I'd just rather LaTeX insert linebreaks before
\myurl{\tt http://stackoverflow.com/questions/1012799/}
regions rather than inside them.
Do you use "hard wrapping" (either yourself or automatically by your editor) by inserting newlines into your source document at a certain line length, or do you write your paragraphs in one continual line and let your editor "soft-wrap" for you?
Also, what editor do you use for this?
Note: I'm interested in how you wrap lines in your TeX source code (.tex file, general prose), not how TeX wraps lines for the final document.
I recently switched to hard-wrapping per sentence (i.e., newline after sentence end only; one-to-one mapping between lines and sentences) for two reasons:
softwrap for a whole paragraph makes typos impossible to spot in version control diffs.
hardwrapped paragraphs look nice until you start to edit them, and if you re-flow a hard wrapped paragraph you end up with a whole bunch of lines changed in the diff for a possibly one word change.
Only wrapping per sentence fixes these two problems:
Small changes are comparatively easy to spot in a diff.
No re-flowing of text, only changes to, insertions of, or removal of single lines.
Looks a bit weird when you first look at it, but is the only compromise I've seen that addresses the two problems of soft and hard wrapping.
Of course, if you're working collaboratively, the answer is to use whatever the other people are using.
I use Emacs (with AUCTeX). After editing or writing a paragraph, I hit M-q to hard-wrap it. It also handles indenting items, and it also formats commented paragraphs. I don't like soft wraps, because they are visually indistinguishable from real newline characters, but behave differently.
I generally let my LaTeX editor softwrap the lines. I think part of it is due to the fact that I had some bad experiences with significant whitespace when I was first learning LaTeX, and part of it is because I don't like heavily-jagged right-margins when I'm editing the text file.
Depending on what os you use, i recommend winedt (windows) and kile (linux). Both of these soft wrap, and there is no need for hard wraps. (That is, i leave my paragraphs as long lines in the source) Latex sorts out line breaks in the output and when i read the source, i use my editor.
The only possible reason to use hard line breaks is to make it easier to find errors in the code (which the compiler indicates by line number) but they are generally not hard to find, if it's mainly text, errors are rare anyway.
Typically I have my editor insert newlines. That is, I try not to hit the "enter" key for a new line, but when the editor soft-wraps, it actually inserts a newline character.
I use vim to accomplish this, and I don't know if other editors have this feature or how they work. In specific, i use the wrapmargin feature.
I typically try to keep my lines of code (TeX or otherwise) at n-characters long for clarity and consistency. I tend to go with 80 characters, but that is up to you.
More vim-related line-breaking docs:
http://www.vim.org/htmldoc/usr_25.html
http://www.vim.org/htmldoc/options.html#%27textwidth%27
I tend to do hard-wrapping with TeX, but that's rooted more in my obsession with text formatting than any real gain of efficiency. One major thing that I don't like about soft-wrapping is that it tends (in my opinion, obviously) to make things harder to read by wrapping in semantically-random places.
Although I would prefer to use soft wrapping I end up using hard wrapping for one practical reason: all of my collaborators do the same. So, when I work on an article with someone it would be a big pain for me to soft wrap while the other person hard wraps. The second reason is that Emacs was until recently able to handle properly on hard wrapping. Emacs 23 which I currently use changes this but it will be a long time before everybody upgrades to 23 so I can sneak soft wrapped texts to them.
The way I actually use hard wrapping is to have auto-fill-mode turned on. Furthermore M-q is bound to LaTeX-fill-paragraph (in the AucTeX mode - but I don't remember if this is a standard binding or one of my bindings - I'm pretty sure it's the latter). Combining these two I manage to keep my TeX source more or less decently formatted.
By the way, I have heard the suggestion to always start a new sentence at the beginning of a line. In other words a period at the end of a sentence should be followed by a hard return. The benefit is that it works well with version control systems since changes to a sentence can remain localized. I think that this is in principle a nice idea but I have not managed to use it because of my obsessive-compulsive usage of M-q.
I use Kile under Linux with hard wrapping (called static word wrap in Kile) because apparently in my work environment everybody do like that. Soft wrapping makes much more sense to me, so if I could choose I would use that rather than hard wrapping.
I work in joe mostly. I from time to time press enter automatically, and if it doesn't look good I press auto-format (ctrl-k j).
Joe has autowrap modes, but I don't even bother.
I use Auctex with automatic line breaking switched off, and insert line breaks by hand. I avoid auto-formatting, since I want as few changes to where line breaks occur between edits to the document, which makes diffs less cluttered.
Using a smarter diff, one that doesn't care about tex-irrelevant whitespace, would be better, but that's the tool I use.
I like Will's suggestion of hard wrapping per sentence. I thought about it before, but I am fixed in my habits.