I would need to insert the following text 'pENN.AAV.CamKII 0.4.Cre.SV40' into my thesis. However, latex applies a double space after each period. I already figured that .\ reduces these to a single space each. However, I want the spaces to be completely removed.
Does anyone have a solution?
Thank you very much!
This looks like some sort of variable name, so you could input it with
\verb|pENN.AAV.CamKII 0.4.Cre.SV40|
Related
I have a problem that requires me to write a regex that finds a line that containing exactly 3 groups of characters (it could be words or numbers) and that ends with another specific word. The way I had in mind was to find a pattern that ended in a space, and look for it 3 times. assuming this is the correct way to go about it, I do no know how to find a space, but I thought it would look like .*"find a space"{3} endword$. Is this the way it would be done? Even if it is not the way to do it how do you find a space? Any suggestions?
Assuming by three groups of words you would accept any non-space character, you could write:
/^\s*(?:\S+\s+){3}endword$/
The initial caret is to make sure you have exactly 3 non-space groups on the line.
Of course you need to consider whether things like control characters could appear, and adjust accordingly.
Depending on your flavor, something like the below would do it:
\b+.+?\b+.+?\b+.+?\bendword$
This makes use of the word boundary mark (\b) and non-greedy repetitions (+?), so it may be slightly different in your specific implementation, especially if you're using something old like grep.
I think this question is novel. Here is the problem I have. I have a relatively short piece of text associated with a lot of figures and a table. I want floats to appear on pages just for floats but in the order I specify. I have set all of the table and figure parameters to [hp] and placed them in the order I want them to appear in the source e.g.
Figure 1
Figure 2
Figure 3
Table 1
Figure 4
Figure 5
The problem I have is that no matter what I do the document typesets like this
Table 1
Figure 1
Figure 2
etc....
I have tried trashing the Aux files before typesetting. I am aware of the endfloats package but I still want latex to place the floats in between larger sections of txts in other parts of the document. Any help is greatly appreciated.
Thanks
I'll try to explain why the fix by #user476160 (placement modifier hp instead of just p) works. A figure is a float, i.e. an element that cannot be broken across a page. The figure environment accepts a parameter list with placement hints:
\begin{figure}[placement parameters]
% ...
\end{figure}
The placement specifier h stands for here and places the figure approximately at the same point as in the source text. The placement specifier p puts the figure in a special page that contains only floats:
\begin{figure}[hp]
% ...
\end{figure}
Wikibooks has an excellent article on figure placement if you want to fine-tune your figure and table placement.
I also recommend posting LaTeX-related questions in the TeX Stack Exchange Q&A.
Problem solved, the first figure in my list had the parameter [p] rather [hp]. This seemed to cause latex a lot of grief for some reason. Anyhow problem solved for now. The figures and txt all appear in the order I have specified.
It is quite easy. All you have to do is use this package.
\usepackage{float}
And you have to change the figure parameters to
\begin{figure}{H}
%..
\end{figure]}
Let me know if it works :)
I know one of LaTeX's bragging points is that it doesn't have this Microsoftish behavior. Nevertheless, it's sometimes useful.
LaTeX already adds an extra space after you type a (non-backslashed) period, so it should be possible to make it automatically capitalize the following letter as well.
Is there an obvious way to write a macro that does this, or is there a LaTeX package that does it already?
The following code solves the problem.
\let\period.
\catcode`\.\active
\def\uppercasesingleletter#1{\uppercase{#1}}
\def.{\period\afterassignment\periodx\let\next= }
\def \periodx{\ifcat\space\next \next\expandafter\uppercasesingleletter \else\expandafter\next\fi}
First. second.third. relax.relax. up
\let\period. save period
\catcode\.\active make all periods to be active symbol (like macro).
\def\uppercasesingleletter#1{\uppercase{#1}} defines macro \uppercasesingleletter to make automatically capitalize the following letter.
\def.{\period\afterassignment\periodx\let\next= } writes saved period and checkes the next symbol.
\def \periodx{\ifcat\space\next \next\expandafter\uppercasesingleletter \else\expandafter\next\fi} If the next letter is a space then \uppercasesingleletter is inserted.
ages ago there was discussion of this idea on comp.text.tex, and the general conclusion was you can't do it satisfactorily. satisfactory, in my book, involves not making characters active, but i can't see how that could work at all.
personally, i would want to make space active, and have it then look at \spacefactor and \MakeUppercase the following character if the factor is 3000.
something like
\catcode\ \active % latex already has a saved space character -- \space
\def {\ifhmode% \spacefactor is invalid
% (or something) in vertical mode
\ifnum\spacefactor<3000\else% note: with space active,
% even cs-ended lines need %-termination
\expandafter\gobbleandupper\fi}%
\def\gobbleandupper#1{\def\tempa{#1}\def\tempb{ }%
\ifx\tempa\tempb% can''t indent the code, either :-(
% here, we have another space
\expandafter\gobbleandupper% try again
\else\space% insert a "real" space to soak up the
% space factor
\expandafter\MakeUppercase\fi}%
this doesn't really do the job -- there are enough loose ends to knit a fairisle jumper. for example, given that we can't rely on \everypar in latex, how do you uppercase the first letter of a paragraph?
no ... however much it hurts (which is why i avoid unnecessary key operations) we need to type latex "properly" :-(
I decided to solve it in the following way:
Since I always compile the LaTeX code three times before i okular the result (to get pagination and references right), I decided to build the capitalization of sentences into that process.
Thus, I now have a shell script that calls my capitalization script (written in CRM114) first, then pdflatex three times, and then okular. This way, all the stuff happens as the result of a single command.
I am using LaTeX and I have a problem concerning string manipulation.
I want to have an operation applied to every character of a string, specifically
I want to replace every character "x" with "\discretionary{}{}{}x". I want to do
this because I have a long string (DNA) which I want to be able to separate at
any point without hyphenation.
Thus I would like to have a command called "myDNA" that will do this for me instead of
inserting manually \discretionary{}{}{} after every character.
Is this possible? I have looked around the web and there wasnt much helpful
information on this topic (at least not any I could understand) and I hoped
that you could help.
--edit
To clarify:
What I want to see in the finished document is something like this:
the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA
AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG
ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT
ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT
CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC
CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT
AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT
just plain linebreaks, without any hyphens. The DNA sequence will be one
long string without any spaces or anything but it can break at any point.
This is why my idea was to inesert a "\discretionary{}{}{}" after every
character, so that it can break at any point without inserting any hyphens.
This takes a string as an argument and calls \discretionary{}{}{} after each character. The input string stops at the first dollar sign, so you should not use that.
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\say{#1}\discretionary{}{}{}%
\takeTheRest#2\ofTheString
\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\say#1{#1}
You’d call it like \hyphenateWholeString{CTAAAGAAAACAGGACG}.
Instead of \discretionary{}{}{} you can also try \hspace{0pt}, if you like that more (and are in a latex environment). In order to align the right margin, I think you’d need to do some more fine tuning (but see below). The effect is of course minimised by using a font of fixed width.
Revision:
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString\unskip}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\transform{#1}%
\takeTheRest#2\ofTheString\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\transform#1{#1\hskip 0pt plus 1pt}
Steve’s suggestion of using \hskip sounds like a very good idea to me, so I made a few corrections. Note that I’ve renamed the \say macro and made it more useful in that it now actually does the transformation. (However, if you remove the \hskip from \transform, you’ll also need to remove the \unskip in the main macro definition.
Edit:
There is also the seqsplit package which seems to be made for printing DNA data or long numbers. They also bring a few options for nicer output, so maybe that is what you’re looking for…
Debilski's post is definitely a solid way to do it, although the \say is not necessary. Here's a shorter way that makes use of some LaTeX internal shortcuts (\#gobble and \#ifnextchar):
\makeatletter
\def\hyphenatestring#1{\xHyphen#te#1$\unskip}
\def\xHyphen#te{\#ifnextchar${\#gobble}{\sw#p{\hskip 0pt plus 1pt\xHyphen#te}}}
\def\sw#p#1#2{#2#1}
\makeatother
Note the use of \hskip 0pt plus 1pt instead of \discretionary - when I tried your example I ended up with a ragged margin because there's no stretchability. The \hskip adds some stretchable glue in between each character (and the \unskip afterwards cancels the extra one we added). Also note the LaTeX style convention that "end user" macros are all lowercase, while internal macros have an # in them somewhere so that users don't accidentally call them.
If you want to figure out how this works, \#gobble just eats whatever's in front of it (in this case the $, since that branch is only run when a $ is the next char). The main point is that \sw#p is only given one argument in the "else" branch, so it swaps that argument with the next char (that isn't a $). We could just as well have written \def\hyphenate#next#1{#1\hskip...\xHyphen#te} and put that with no args in the "else" branch, but (in my opinion) \sw#p is more general (and I'm surprised it's not in standard LaTeX already).
There is a contrib package on CTAN that deals with typesetting DNA sequences. It does a little more than just line-breaking, for example, it also supports colouring. I'm not sure if it is possible to get the output you are after though, and I have no experience in the DNA-sequence-typesetting area, but is one long string the most readable representation?
Assuming your string is the same, in your preamble, use the \newcommand{}{}. Like this:
\newcommand{\myDNA}{blah blah blah}
if that doesn't satisfy your requirements, I suggest:
2. Break the strings down to the smallest portion, then use the \newcommand and then call the new commands in sequence: \myDNA1 \myDNA2.
If that still doesn't work, you might want to look at writing a perl script to satisfy your string replacement needs.
How can I prevent LaTeX from inserting linebreaks in my \texttt{...} or \url{...} text regions? There's no spaces inside I can replace with ~, it's just breaking on symbols.
Update: I don't want to cause line overflows, I'd just rather LaTeX insert linebreaks before these regions rather than inside them.
\mbox is the simplest answer. Regarding the update:
TeX prefers overlong lines to adding too much space between words on a line; I think the idea is that you will notice the lines that extend into the margin (and the black boxes it inserts after such lines), and will have a chance to revise the contents, whereas if there was too much space, you might not notice it.
Use \sloppy or \begin{sloppypar}...\end{sloppypar} to adjust this behavior, at least a little. Another possibility is \raggedright (or \begin{raggedright}...\end{raggedright}).
Surround it with an \mbox{}
Also, if you have two subsequent words in regular text and you want to avoid a line break between them, you can use the ~ character.
For example:
As we can see in Fig.~\ref{BlaBla}, there is nothing interesting to see. A~better place..
This can ensure that you don't have a line starting with a figure number (without the Fig. part) or with an uppercase A.
Use \nolinebreak
\nolinebreak[number]
The \nolinebreak command prevents LaTeX from
breaking the current line at the point of the command. With the
optional argument, number, you can convert the \nolinebreak command
from a demand to a request. The number must be a number from 0 to 4.
The higher the number, the more insistent the request is.
Source: http://www.personal.ceu.hu/tex/breaking.htm#nolinebreak
Define myurl command:
\def\myurl{\hfil\penalty 100 \hfilneg \hbox}
I don't want to cause line overflows,
I'd just rather LaTeX insert linebreaks before
\myurl{\tt http://stackoverflow.com/questions/1012799/}
regions rather than inside them.