can anyone explain what DA, LH and LF means in this report and what are each numbers?
bazel-out/_coverage/_coverage_report.dat
TN:
SF:src/services/guava/keys/keys.go
DA:16,1
DA:17,1
DA:18,1
DA:19,1
DA:20,0
LH:83
LF:109
end_of_record
Related
I would like to trim the beginning of all the reads in fastq file by a given length, before mapping to the genome with bowtie2. I have used Cutadapt:
cutadapt -u 48 -o output.fastq.gz input.fastq.gz
my fastq files after trimming looks like this:
gunzip -c output.fastq.gz | head
#NB502143:99:HFF7TAFX2:1:11101:4133:1019 1:N:0:ATCACG
CATGAAAAAGAGCTCATTTTCAGATGCAGGAATTCCTATCCG
+
EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
#NB502143:99:HFF7TAFX2:1:11101:19790:1020 1:N:0:ATCACG
CATGATCCACTTTTCCACGCGCTTTGACGACCATTTTATAA
+
EEEEE<EEEEEEEEEEEEEEEEE<EE/EEAEEEEEEEEEEE
#NB502143:99:HFF7TAFX2:1:11101:6327:1020 1:N:0:ATCACG
CATGATCTCAGTAAAGGCATTTGTGGTTGTTAAGTAGCCATT
When I try to map it with bowtie2, I get the following error message:
Saw ASCII character 10 but expected 33-based Phred qual.
I don't get this error if I map input.fastq.gz, so I suspect something wrong is happening during the trimming but I can't figure out what!
I checked both files with FastQC and they're both Sanger / Illumina 1.9 encoded.
Thanks for your help.
I have been having a similar issue. The error occurs when I use cutadapt, but does not happen when I trim with another tool, fastp.
Checking the integrity of the resulting trimmed fastq files showed that some reads had no bases. A tool like fastq_info from the fastq_utils package would work.
If there is an issue, you might need to use the -m <minimum-length> flag when running cutadapt. This will remove reads below a designated length. Alignment after that should work if that was the issue.
I've been using Doxygen successfully to generate PDF documentation for a sizable Fortran 90 project since v1.6. After a recent upgrade to Doxygen 1.8, pdflatex is choking with an error I can't understand. From refman.log:
.
.
.
<use classfate__source_a022bf629bdc1d3059ebd5fb86d13b4f4_icgraph.pdf>
Package pdftex.def Info: classfate__source_a022bf629bdc1d3059ebd5fb86d13b4f4_ic
graph.pdf used on input line 607.
(pdftex.def) Requested size: 350.0pt x 65.42921pt.
)
(./classm__aerosol.tex
! Undefined control sequence.
<recently read> \LT#LL#FM#cr
l.25 ...1833ffa6f2fae54ededb}{ia\-\_\-nsize}), \\*
? ?
Type <return> to proceed, S to scroll future error messages,
R to run without stopping, Q to run quietly,
I to insert something, E to edit your file,
1 or ... or 9 to ignore the next 1 to 9 tokens of input,
H for help, X to quit.
Looking at the first 25 lines of classm__aerosol.tex, nothing obviously matches the error message:
\hypertarget{classm__aerosol}{\section{m\-\_\-aerosol Module Reference}
\label{classm__aerosol}\index{m\-\_\-aerosol#{m\-\_\-aerosol}}
}
Contains general aerosol-\/related constants and routines.
\subsection*{Public Member Functions}
\begin{DoxyCompactItemize}
\item
subroutine \hyperlink{classm__aerosol_aa06c1f39c6bd34f22be92d21535f0320}{aerdis} (I\-A\-E\-R\-O, M\-A\-E\-R\-O, V\-O\-L, A\-R\-E\-A, M\-U, T\-G\-A\-S, R\-H\-O, A\-G\-A\-M\-M\-A, X\-L\-A\-E\-R, D\-M\-E\-A\-N, N\-A\-E\-R, X\-N\-D\-A\-E\-R, L\-S\-D\-A\-E\-R)
\begin{DoxyCompactList}\small\item\em Return aerosol mass given a volume, based on aerosol size distribution function. \end{DoxyCompactList}\item
real(kind=wp) function \hyperlink{classm__aerosol_a2dff4ff413057e8788fba7270a30c093}{lamsed} (V\-O\-L, H, M\-U\-G, R\-H\-O\-A\-E\-R, A\-G\-A\-M\-M\-A, A\-C\-H\-I, A\-F\-E\-O, K\-O, M\-A\-E\-R, F\-M\-A\-E\-R, F\-A\-E\-R\-S\-S, F\-S\-E\-D\-D\-K)
\begin{DoxyCompactList}\small\item\em Calculate aerosol removal constant and interpolation factor between steady-\/state and decaying aerosol correlations. \end{DoxyCompactList}\item
pure real(kind=wp) function \hyperlink{classm__aerosol_a6d0a04004f49c404c67e0aa69dd39ee1}{fdbend} (V\-E\-L, H\-S\-E\-D, T\-G, R\-H\-O\-G, M\-U\-G, R\-H\-O\-P\-A\-R, C\-A\-E\-R\-O, X\-D\-B\-E\-N\-D, N90\-J)
\begin{DoxyCompactList}\small\item\em Find total impaction efficiency for aerosol deposition considering 90-\/degree bends in a flow path. \end{DoxyCompactList}\end{DoxyCompactItemize}
\subsection*{Public Attributes}
\begin{DoxyCompactItemize}
\item
integer, parameter \hyperlink{classm__aerosol_a8f604b7ffe3c1833ffa6f2fae54ededb}{ia\-\_\-nsize} = 30
\item
integer, parameter \hyperlink{classm__aerosol_ae71813ecf0c7768af9d6292efb14774f}{ia\-\_\-nmass} = 10
\item
real(kind=wp), dimension(\hyperlink{classm__aerosol_a8f604b7ffe3c1833ffa6f2fae54ededb}{ia\-\_\-nsize}), \\*
Nothing obviously matches the recently read chunk "\LT#LL#FM#cr" and I don't know enough low-level TeX to translate that into something that might actually be in the source text.
Suspecting this might have been fixed in a later version of Doxygen than the one shipping with Linux Mint (v1.8.1.2), I built & installed v1.8.3.1 from source, updated my doxyfile, blew away the old documentation and regenerated it. I get the same baffling error.
There's nothing obvious in refman.log that would indicate missing or broken LaTeX packages and I'm completely at a loss as to what's causing this.
As this still gets a hit on Google when you search:
doxygen missing $ inserted
I would like to add something.
Do not use a PROJECT_NAME containing underscores (_)!
After a brief look into the doxygen's current documentation (I am using 1.8.4) it does not make that explicit.
this will be difficult to solve unless you provide a bit more information - possibly using \errorcontextlines=9999 as suggested in the comments on the question.
as a first short though, the name of the control sequence that can't be found (i.e. \LT#LL#FM#cr) is one defined by the longtable package (documentation, p. 15) - thus adding:
\usepackage{longtable}
to the preamble of the document might help.
If so, according to the doxygen documentation here, adding the following to your configuration file should do the trick:
EXTRA_PACKAGES=longtable
I'm coding a unit test where a (rather lengthy) binary is generated, and I want to assert that the generated binary equals the one I expect to be generated. I'm running eunit through "rebar eunit".
Thing is, when this assertion fails, the output is abreviated with "...", and I want to see the complete output so I can spot where the difference is.
I'm now using "?debugFmt()" as a temporary solution, but I'd like to know if there's an alternative to it (a config option or argument somewhere that can be applied to "?_assertEqual()" so the output is only shown when the assertion fails).
Thanks in advance!
EDIT: Due to legoscia's answer, I'm including a test sample using a test generator, with multiple asserts:
can_do_something(SetupData) ->
% ... some code ...
[?_assertEqual(Expected1, Actual1), ?_assertEqual(Expected2, Actual2)].
The best I can think of for actually showing the value in the console is something like this:
Actual =:= Expected orelse ?assert(?debugFmt("~p is not ~p", [Actual, Expected]))
?debugFmt returns ok, which is not true, so the assertion will always fail.
Alternatively, to use it as a test generator, the entire thing can be put inside ?_assert:
?_assert(Actual =:= Expected orelse ?debugFmt("~p is not ~p", [Actual, Expected]))
The way I usually achieve this is by having Eunit output XML files (in "Surefire" format, AKA "Junit" format). The XML files have much higher limits for term print depth, and thus probably contain the information you need.
Add this to your rebar.config:
{eunit_opts,
[verbose,
%% eunit truncates output from tests - capture full output in
%% XML files in .eunit
{report,{eunit_surefire,[{dir,"."}]}}]}.
Then you can find the results for module foo in .eunit/TEST-foo.xml. I find the files quite readable in a text editor.
1). Open your eunit sources. In my system:
cd /usr/lib/erlang/lib/eunit-2.3.2/src
2). Edit eunit_lib.erl in such way:
diff
54c54
< format_exception(Exception, 20).
---
> format_exception(Exception, 99999).
3). sudo erlc -I ../include eunit_lib.erl
4). mv eunit_lib.beam ../ebin
5). Have a good day))
This PR introduces print_depth option to eunit:test/2:
eunit:test(my_test, [{print_depth, 200}]).
It should be available starting from OTP-23.
Setting print_depth to a larger number will decrease truncation of the output.
Why i need to use it is because for some printers using TPrinter prints some weird hieroglyph at the beginning of the printable area.
My problem is that if i send some commands, nothing happens.
ESC E (#27 #69) - Sending this escape sequence didn't work as i expected. It removed first letter and rest of the string made bold. eg. Hello -> ello. After i changed it to ESC E ESC (#27 #69 #27), it worked fine. This example i managed to figure out, but...
trying to select character table "ESC t n" (#27 #116 n), to make "õäöü" work. This command just doesn't work. Nothing happens! And this command is supported by esc/p, esc/p 2 and 9-pin esc/p, so it should work just fine.
Manual can be found here.
If anyone has ever needed to use esc/p commands then maybe one can shed some light how to work with them!
Thanks in advance!
EDIT:
In my previous post i asked more or less the same question though answers were about how did i send commands to the printer. (I'll change my question there according to what was the answers!)
I accepted Ken's answer, because he claimed that the way i transferred the commands wasn't the best and i got it to work with Escape command.
The problem was that after trying to use my program with another printer, it didn't work as expected, because it uses TPrinter.Begindoc and EndDoc.
So actually i must use the other solution that Rob Kennedy helped me with!
EDIT 2:
As it turned out, i used wrong manual, where commands are little different (though still supporting esc/p as it proclaims). Thank you all for your help!
PS!
I still have a question: I need a character table where
245 = õ
228 = ä
246 = ö
252 = ü
which is iso 8859. But in manual there is no such character table or any similar to it. Should i do some string manipulation and replace eg 228 to 132 or does anyone know any better approuch?
I keep it unanswered for a while, and then accept stukelly's answer.
Based on your previous question, I think you are using the wrong commands to control the EPSON TM-T70 receipt printer. After some research I found the product brochure and POSMicro both mention ESC/POS.
The ESC/POS command for turning bold on and off requires has a third value, as follows.
ASCII ESC E n
Hex 1B 45 n
Decimal 27 69 n
Where n is 0 or 1, turning bold off or on.
Here is a detailed ESC/POS reference.
I want to load this simple something into my Editor:
Write:-repeat,write("hi"),nl,fail.
So that it prints "hi".
What should I do?
I'm currently trying to do File->New
and Saving a file named Write into E:\Program Files\pl\xpce\prolog\lib
When doing the query:
?-Write.
It's printing:
1 ?- Write.
% ... 1,000,000 ............ 10,000,000 years later
%
% >> 42 << (last release gives the question)
Why?
EDIT
I did some more research. Apparently this is what SWI-Prolog does when you ask it about an uninstantiated variable.
$ prolog
Welcome to SWI-Prolog (Multi-threaded, 64 bits, Version 5.6.64)
Copyright (c) 1990-2008 University of Amsterdam.
SWI-Prolog comes with ABSOLUTELY NO WARRANTY. This is free software,
and you are welcome to redistribute it under certain conditions.
Please visit http://www.swi-prolog.org for details.
For help, use ?- help(Topic). or ?- apropos(Word).
?- X.
% ... 1,000,000 ............ 10,000,000 years later
%
% >> 42 << (last release gives the question)
?-
UPDATE
Changing the name to lowercase works. Uppercase is for variables:
helloworld.prolog:
helloworld:-write('Hello World!'),nl,fail.
Then:
$ prolog
Welcome to SWI-Prolog (Multi-threaded, 64 bits, Version 5.6.64)
Copyright (c) 1990-2008 University of Amsterdam.
SWI-Prolog comes with ABSOLUTELY NO WARRANTY. This is free software,
and you are welcome to redistribute it under certain conditions.
Please visit http://www.swi-prolog.org for details.
For help, use ?- help(Topic). or ?- apropos(Word).
?- ['helloworld.prolog'].
% helloworld.prolog compiled 0.00 sec, 1,376 bytes
true.
?- helloworld.
Hello World!
false.
?-
Notice that you have to consult the file first. I tried this out and it works for sure.
You need to name the procedure write, not Write. Upper case starting letters are for variables. (It might be less confusing if you call it something else like writeHi or something, so it doesn't have the same name as a built-in procedure, but it will still work when you call it write because your write has a different arity than the built in one).
Also you might want to replace "hi" with 'hi', though it will work either way (but only the second version will actually print the word hi to the screen - your version will print it as an integer list).