i am new in using notion as a notebook.Before this,i use oneNote instead,because i found that notion is more convinient in same ways.But one thing making me annoyed is that i can't add subscript(or superscript) in notion text block。Are there any fellows can handle this？
as shown：
text with subscript i need
when i edit in notion block i get like this
For subscript:
/math
Then C_1 renders C1
For superscript:
/math
Then C^2 renders C2
In the latest version as of writing, you could use:
$$c^2$$ - for superscript
$$c_2$$ - for subscript
If you write any mathematical equation between $$ $$, it will render beautifully on notion.
For more than 1 character superscript
/math
P^{xyz}
Result: Pxyz
For more than 1 character subscript
/math
P_{xyz}
Result: Pxyz
In fact, this works for 1 or many characters as subscript or superscript.
Even I just started using notion and faced the same problem. The solution I found was to keep a tab of laTex containing the syntax for all the required math formulae open. It is only temporary as you will get used to them pretty quickly.
You can use tex to write things is superscript or subscript or basically any type of formulae , but its still in tex.
I did and worked on my Notion
Step 1: Choose what to add subscript(or superscript) in notion block (Example a^n)
Step 2: Choose symbol sqrt(x)
Step 3: Press "Done"
In Notion, there are two ways to add math formulas: inline equations and block equations. Both use KaTeX formatting to show the formulas. KaTeX is a TeX display formulas method based on JavaScrpt language. When you place a block or inline equation, for your example, you have to do something like that in the code:
w_{1}=0 ~,~ w_{2}=1
Note that spaces are not rendered, you gotta use ~ separate things, and the { } on these subscripts are optional because when not placed, the "" will take just the first next character. To do superscript, change the "" to "^". You can combine both in the same main variable, like w_2^2=1.
In the following links, you can see a Notion's guide about how to use it, the supported features KaTeX allows you to do, and a link to easy creating formulas.
Notion:
https://www.notion.so/help/math-equations
KaTeX Supported Functions:
https://katex.org/docs/supported.html or
https://katex.org/docs/support_table.html
Easy web TeX editor:
https://atomurl.net/math/
Take time to try and explore writing by typping. Then, when you get used to it, it flows easily like writing regular text.
For anyone stumbling upon this question who does not want to write math equations but simply wants to add a couple of superscript or exponent elements to a Notion page, for instance to write footnotes: there seems to be no way to add "simple" superscript (inline and with the same font), but you can use superscript unicode characters, for instance with a tool such as this one.
It is not perfect as many characters are not available, but will cover many¹ common² uses³ of superscriptᶜᶦᵗᵃᵗᶦᵒⁿ ⁿᵉᵉᵈᵉᵈ.
Related
Problem
I'm writing an essay/documentation about an application. Within this doc there are a lot of code-words which I want to be highlighted using a different font. Currently I work with:
{\fontfamily{cmtt}\selectfont SOME-KEY-WORD}
Which is a bit of work to use every time.
Question
I'm looking for a way to declare a list of words to use a specific font within the text.
I know that I can use the listings package and define morekeywords which will be highlighted within the listings-environment but I need it in the text.
I thought of something like this:
\defineList{\fontfamily{cmtt}}{
SOME-KEY-WORD-1,
SOME-Key-word-2,
...
}
EDIT
I forgot to mention that I already tried something like:
\def\somekeyword{\fontfamily{cmtt}\selectfont some\_key\_word\normalfont}
which is a little bit better then the first attempt but I still need to use \somekeyword in the text.
EDIT 2
I came upon a workaround:
\newcommand{\cmtt}[1]{{\fontfamily{cmtt}\selectfont #1\normalfont}}
It's a little better then EDIT but still not the perfect solution.
Substitution every time a word occurs, without providing any clues to TeX, might be difficult and is beyond my skills (though I'd be interested to see someone come up with a solution).
But why not simply create a macro for each of those words?
\newcommand\somekeyword{\fontfamily{cmtt}\selectfont SOME-KEY-WORD}
Use like this:
Hello, \somekeyword{} is the magic word!
The trailing {} are unfortunately necessary to prevent eating the subsequent whitespace; even the built-in \LaTeX command requires them.
If you have very many of these words and are worried about maintainability, you can even create a macro to create the macros:
\newcommand\declareword[2][]{%
\expandafter\newcommand%
\csname\if\relax#1\relax#2\else#1\fi\endcsname%
{{\fontfamily{cmtt}\selectfont #2}}%
}
\declareword{oneword} % defines \oneword
\declareword{otherword} % defines \otherword
\declareword[urlspy]{urls.py} % defines \urlspy
...
The optional argument indicates the name of the command, in case the word itself contains characters like . which cannot be used in the name of a command.
I am using LaTeX and I have a problem concerning string manipulation.
I want to have an operation applied to every character of a string, specifically
I want to replace every character "x" with "\discretionary{}{}{}x". I want to do
this because I have a long string (DNA) which I want to be able to separate at
any point without hyphenation.
Thus I would like to have a command called "myDNA" that will do this for me instead of
inserting manually \discretionary{}{}{} after every character.
Is this possible? I have looked around the web and there wasnt much helpful
information on this topic (at least not any I could understand) and I hoped
that you could help.
--edit
To clarify:
What I want to see in the finished document is something like this:
the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA
AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG
ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT
ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT
CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC
CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT
AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT
just plain linebreaks, without any hyphens. The DNA sequence will be one
long string without any spaces or anything but it can break at any point.
This is why my idea was to inesert a "\discretionary{}{}{}" after every
character, so that it can break at any point without inserting any hyphens.
This takes a string as an argument and calls \discretionary{}{}{} after each character. The input string stops at the first dollar sign, so you should not use that.
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\say{#1}\discretionary{}{}{}%
\takeTheRest#2\ofTheString
\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\say#1{#1}
You’d call it like \hyphenateWholeString{CTAAAGAAAACAGGACG}.
Instead of \discretionary{}{}{} you can also try \hspace{0pt}, if you like that more (and are in a latex environment). In order to align the right margin, I think you’d need to do some more fine tuning (but see below). The effect is of course minimised by using a font of fixed width.
Revision:
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString\unskip}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\transform{#1}%
\takeTheRest#2\ofTheString\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\transform#1{#1\hskip 0pt plus 1pt}
Steve’s suggestion of using \hskip sounds like a very good idea to me, so I made a few corrections. Note that I’ve renamed the \say macro and made it more useful in that it now actually does the transformation. (However, if you remove the \hskip from \transform, you’ll also need to remove the \unskip in the main macro definition.
Edit:
There is also the seqsplit package which seems to be made for printing DNA data or long numbers. They also bring a few options for nicer output, so maybe that is what you’re looking for…
Debilski's post is definitely a solid way to do it, although the \say is not necessary. Here's a shorter way that makes use of some LaTeX internal shortcuts (\#gobble and \#ifnextchar):
\makeatletter
\def\hyphenatestring#1{\xHyphen#te#1$\unskip}
\def\xHyphen#te{\#ifnextchar${\#gobble}{\sw#p{\hskip 0pt plus 1pt\xHyphen#te}}}
\def\sw#p#1#2{#2#1}
\makeatother
Note the use of \hskip 0pt plus 1pt instead of \discretionary - when I tried your example I ended up with a ragged margin because there's no stretchability. The \hskip adds some stretchable glue in between each character (and the \unskip afterwards cancels the extra one we added). Also note the LaTeX style convention that "end user" macros are all lowercase, while internal macros have an # in them somewhere so that users don't accidentally call them.
If you want to figure out how this works, \#gobble just eats whatever's in front of it (in this case the $, since that branch is only run when a $ is the next char). The main point is that \sw#p is only given one argument in the "else" branch, so it swaps that argument with the next char (that isn't a $). We could just as well have written \def\hyphenate#next#1{#1\hskip...\xHyphen#te} and put that with no args in the "else" branch, but (in my opinion) \sw#p is more general (and I'm surprised it's not in standard LaTeX already).
There is a contrib package on CTAN that deals with typesetting DNA sequences. It does a little more than just line-breaking, for example, it also supports colouring. I'm not sure if it is possible to get the output you are after though, and I have no experience in the DNA-sequence-typesetting area, but is one long string the most readable representation?
Assuming your string is the same, in your preamble, use the \newcommand{}{}. Like this:
\newcommand{\myDNA}{blah blah blah}
if that doesn't satisfy your requirements, I suggest:
2. Break the strings down to the smallest portion, then use the \newcommand and then call the new commands in sequence: \myDNA1 \myDNA2.
If that still doesn't work, you might want to look at writing a perl script to satisfy your string replacement needs.
It seems to be common practice, when writing mathematics, to add punctuation to displayed formulas.
Is there any trick to avoid putting the punctuation mark inside the formula?
I want to avoid
Consider the function
\[ \sin(x).\]
I'd rather have something like:
Consider the function
\[ \sin(x)\].
But of course the full stop is displayed below the formula.
Is there a clever way to separate formulas and punctuation in LaTeX?
\catcode`\#=11
\let\seveendformula\]
\def\]{\#ifnextchar.\PointAndEndFormula\seveendformula}
\def \PointAndEndFormula #1{.\seveendformula}
\catcode`\#=12
Add
More complex solution works with .,?!;: :
\catcode`\#=11
\def\addtopunct#1{\expandafter\let\csname punct#\meaning#1\endcsname\let}
\addtopunct{.} \addtopunct{,} \addtopunct{?}
\addtopunct{!} \addtopunct{;} \addtopunct{:}
\let\seveendformula\]
\def\PunctAndEndFormula #1{#1\seveendformula}
\def\]{\futurelet\punctlet\checkpunct#i}
\def\checkpunct#i{\expandafter\ifx\csname punct#\meaning\punctlet\endcsname\let
\expandafter\PunctAndEndFormula
\else \expandafter\seveendformula\fi}
\catcode`\#=12
There's also the issue of which font the punctuation should be in. You won't see a problem until you try a different math font such as Euler. Then commas and periods are clearly different in text mode and in math mode. I've written text-mode punctuation in displayed formulas as \mbox{,} or lazily as \mbox, just before $$.
You can load the breqn package (compatible with amsmath) and have this behaviour inbuilt with its dmath environment:
Consider the function
\begin{dmath}\sin(x)\end{dmath}.
Will output the same as \[\sin(x).\], i.e., as if the dot was inside the expression.
As a bonus, you'll also get automatic line-breaking in your math equation.
Putting the punctuation inside a display environment is the usual way. The problem is that when Latex processes the \], it ends the mathbox, so anything following will be part of a new vertical box.
You could try something like:
\hbox{\[My formula\]}.
This is not tested, and probably has spacing issues, but if you are interested in this kind of solution, I could try and get something working.
FWIW, you might be interested in https://mathoverflow.net/questions/6675/periods-and-commas-in-mathematical-writing
I want LaTeX to automatically replace strings like " a ", " s ", " z " with " a~", " s~", " z~", because they can't be at line end. Any suggestions?
For Czech typographic rules, there is a preprocessor called Vlna" by Petr Olšák - download . The set of (usually prepositions in czech) is customizable - so it might be usable for other languages as well.
You can use \StrSubstitute from xstring package.
e.g.
\StrSubstitute{change ME}{ ME}{d}
will convert change ME into changed.
Although, nesting is not possible, so to make another substitution you must use an intermediate variable in this way
\StrSubstitute{change ME}{ ME}{d}[\mystring]
\StrSubstitute{\mystring}{ed}{ing}
Finally, your solution would be
\usepackage{xstring}
\def\mystring{...source string here...}
\begin{document}
\StrSubstitute{\mystring}{ a }{a~{}}[\mystring]
\StrSubstitute{\mystring}{ s }{s~{}}[\mystring]
\StrSubstitute{\mystring}{ z }{z~{}}[\mystring]
\mystring
\end{document}
Note the use of the empty string {} to avoid the sequence ~}.
I'm afraid (to the best of my knowledge) this is basically impossible with LaTeX. A LuaTeX-based solution might be possible, though.
It's not actually clear to me, however, that " a ", for example, shouldn't appear at the end of a
line. Although I might be used to different typographic rules.
(Is there anything wrong with the line break in the last paragraph? :))
As far as I know there is no way to do this in LaTeX itself. I'd go for automating this with some external tools, as my typical setup involves a Makefile handling the LaTeX run by itself. This makes it rather easy to run tools like sed on the sources and do some replacements using regular expressions, and a simple rule would do this for your case.
If you use some LaTeX editor that does everything for you you should check the editors regular expression search and replace functionality.
Yes, this is the age old argument of data processing vs. data composition. We have always done these things in a pre-processor environment responsible for extracting the information from its source environment, SQL or plain-text, and created the contents of a \input(file.tex).
But yes, it is possible (TeX is after all a programming language) but you will have to become a wizard. Get the 4 volume set TeX in Practice by Stephan von Bechtolsheim.
The approach would be to begin an environment (execute a macro) whose ''argument'' was all text down to the end of the environment. Then just munge though the tokens fixing the ones you want.
Still, I don't think any of us are advocating this approach.
If you are using TeXmaker to write your LaTeX file, then you may click on the Edit button on the toolbar, then click on Replace.
A dialogue box will come up, and you can enter your strings one after the other.
You put the strings to be changed in the Find text input and what you want it to be changed to in the Replace text input.
You can also specify where you want the replacement to start from.
Click Find and Replace (or similiar) in the menu of your text editor and do it.
When I write math in LaTeX I often need to perform simple arithmetic on numbers in my LaTeX source, like 515.1544 + 454 = ???.
I usually copy-paste the LaTeX code into Google to get the result, but I still have to manually change the syntax, e.g.
\frac{154,7}{25} - (289 - \frac{1337}{42})
must be changed to
154,7/25 - (289 - 1337/42)
It seems trivial to write a program to do this for the most commonly used operations.
Is there a calculator which understand this syntax?
EDIT:
I know that doing this perfectly is impossible (because of the halting problem). Doing it for the simple cases I need is trivial. \frac, \cdot, \sqrt and a few other tags would do the trick. The program could just return an error for cases it does not understand.
WolframAlpha can take input in TeX form.
http://blog.wolframalpha.com/2010/09/30/talk-to-wolframalpha-in-tex/
The LaTeXCalc project is designed to do just that. It will read a TeX file and do the computations. For more information check out the home page at http://latexcalc.sourceforge.net/
The calc package allows you to do some calculations in source, but only within commands like \setcounter and \addtolength. As far as I can tell, this is not what you want.
If you already use sage, then the sagetex package is pretty awesome (if not, it's overkill). It allows you get nicely formatted output from input like this:
The square of
$\begin{pmatrix}
1 & 2 \\
3 & 4
\end{pmatrix}$
is \sage{matrix([[1, 2], [3,4]])^2}.
The prime factorization of the current page number is \sage{factor(\thepage)}
As Andy says, the answer is yes there is a calculator that can understand most latex formulas: Emacs.
Try the following steps (assuming vanilla emacs):
Open emacs
Open your .tex file (or activate latex-mode)
position the point somewhere between the two $$ or e.g. inside the begin/end environment of the formula (or even matrix).
use calc embedded mode for maximum awesomeness
So with point in the formula you gave above:
$\frac{154,7}{25} - (289 - \frac{1337}{42})$
press C-x * d to duplicate the formula in the line below and enter calc-embedded mode which should already have activated a latex variant of calc for you. Your buffer now looks like this:
$\frac{154,7}{25} - (289 - \frac{1337}{42})$
$\frac{-37651}{150}$`
Note that the fraction as already been transformed as far as possible. Doing the same again (C-x * d) and pressing c f to convert the fractional into a floating point number yields the following buffer:
$\frac{154,7}{25} - (289 - \frac{1337}{42})$
$\frac{-37651}{150}$
$-251.006666667$
I used C-x * d to duplicate the formula and then enter embedded mode in order to have the intermediate values, however there is also C-x * e which avoids the duplication and simply enters embedded mode for the current formula.
If you are interested you should really have a look at the info page for Emacs Calc - Embedded Mode. And in general the help for the Gnu Emaca Calculator together with the awesome interactive tutorial.
You can run an R function called Sweave on a (mostly TeX with some R) file that can replace R expressions with their results in Tex.
A tutorial can be found here: http://www.scribd.com/doc/6451985/Learning-to-Sweave-in-APA-Style
My calculator can do that. To get the formatted output, double-click the result formula and press ctrl+c to copy it.
It can do fairly advanced stuff too (differentiation, easy integrals (and not that easy ones)...).
https://calculator-algebra.org/
A sample computation:
https://calculator-algebra.org:8166/#%7B%22currentPage%22%3A%22calculator%22%2C%22calculatorInput%22%3A%22%5C%5Cfrac%7B1%2B2%7D%7B3%7D%3B%20d%2Fdx(arctan%20(2x%2B3))%22%2C%22monitoring%22%3A%22true%22%7D
There is a way to do what you want just not quite how you describe.
You can use the fp package (\usepackage[options]{fp}) the floating point package will do anything you want; solving equations, adding dividing and many more. Unfortunately it will not read the LaTeX math you instead have to do something a little different, the documentation is very poor so I'll give an example here.
for instance if you want to do (2x3)/5 you would type:
\FPmul\p{2}{3} % \p is the assignment of the operation 2x3
\FPupn\p{\p{} 7 round} % upn evaluates the assignment \p and rounds to 7dp
\FPdiv\q{\p}{5} % divides the assigned value p by 5 names result q
\FPupn\q{\q{} 4 round} % rounds the result to 4 decimal places and evaluates
$\frac{2\times3}{5}=\FPprint\q$ % This will print the result of the calculations in the math.
the FP commands are always ibvisible, only FPprint prints the result associated with it so your documents will not be messy, FP commands can be placed wherever you wish (not verb) as long as they are before the associated FPprint.
You could just paste it into symbolab which as a bonus has free step by step solutions. Also since symbolab uses mathquill it instantly formats your latex.
Considering that LaTeX itself is a Turing-complete markup language I strongly doubt you can build something like this that isn't built directly into LaTeX. Furthermore, LaTeX math matkup itself has next to no semantic meaning, it merely describes the visual appearance.
That being said, you can probably hack together something which recognizes a non-programmable subset of LaTeX math markup and spits out the result in the same way. If all you're interested in is simple arithmetics with fractions and integers (careful with decimal fractions, though, as they may appear as 3{,}141... in German texts :)) this shouldn't be too hard. But once you start with integrals, matrices, etc. I fear that LaTeX lacks expressiveness to accurately describe your intentions. It is a document preparation system, after all and thus not very suitable as input for computer algebra systems.
Side note: You can switch to Word which has—in its current version—a math markup language which is sufficiently LaTeX-like (by now it even supports LaTeX markup) and yet still Google-friendly for simpler terms:
With the free Microsoft Math add-in you can even let Word calculate expressions in-place:
There is none, because it is generally not possible.
LaTeX math mode markup is presentational markup and there are cases in which it does not provide enough information to calculate the expression.
That was one of the reasons MathML content markup was created and also why MathML is used in Mathematica. MathML actually is sort of two languages in one:
presentation markup
content markup
To accomplish what you are after you'll have to have MathML with comibned presentation and content markup (see MathML spec).
In my opinion your best bet is to use MathML (even if it is verbose) and convert to LaTeX when necessary. That said, I also like LaTeX syntax best and maybe what we need is a compact syntax for MathML (something similar in spirit to RelaxNG compact syntax).
For calculations with LaTeX you can use a CalcTeX package.
This package understand elements of LaTeX language and makes an calculations, for example your problem is avialble on
http://sg.bzip.pl/CalcTeX/examples/frac.tgz
or just please write
\noindent
For calculation please use following enviromentals
$515.1544 + 454$
or
\[ \frac{154.7}{25}-(289-\frac{1337}{42.})
\]
or
\begin{equation}
154.7/25-(289-1337/42.)
\end{equation}
For more info please visite project web site or contact author of this project.
For performing the math within your LaTeX itself, you might also look into the pgfmath package, which is more powerful and convenient than the calc package. You can find out how to use it from Part VI of The TikZ and PGF Packages Manual, which you can find here (version 2.10 currently): http://mirror.unl.edu/ctan/graphics/pgf/base/doc/generic/pgf/pgfmanual.pdf
Emacs calc-mode accepts latex-input. I use it daily. Press "d", followed by "L" to enter latex input mode. Press "'" to open a prompt where you can paste your tex.
Anyone saing it is not possible is wrong.
IIRC Mathematica can do it.
There is none, because it is generally not possible. LaTeX math mode
markup is presentational markup and there are cases in which it does
not provide enough information to calculate the expression.
You are right. LaTeX as it is does not provide enough info to make any calculations.Moreover, it does not represent any information to do it. But nobody prevents to wright in LaTeX format a text that contains such an information.
It is a difficult path, because you need to build a system of rules superimposed on what content ofthe text in Latex format needs to contain that it would be recognizable by your interpreter. And then convince the user that it is necessary to learn, etc. etc...
The easiest way to create a logical and intuitive calculator of mathematical expressions. And the expression is already possible to convert latex. It's almost like what you said. This is implemented in the program which I have pointed to. AnEasyCalc allows to type an expression as you type the plane text in any text editor. It checks, calculates and generate LateX string by its own then. Its very easy and rapid work. Just try and you will see that.
This is not exactly what you are asking for but it is a nice package
that you can include in a LaTeX document to do all kind of operations including arithmetic, calculus and even vectors and matrices:
The package name is "calculator"
http://mirror.unl.edu/ctan/macros/latex/contrib/calculator/calculator.pdf
The latex2sympy2 Python library can parse LaTeX math expressions.
from latex2sympy2 import latex2sympy
tex_str = r"""YOUR TEX MATH HERE"""
tex_str = r"\frac{9\pi}{\ln(12)}+22" # example TeX math
sympy_object = latex2sympy(tex_str)
evaluated_tex = float(sympy_object.evalf())
print(evaluated_tex)
This Python 3 code evaluates 9𝜋/ln(12)+22 (in its LaTeX from above) to 33.37842899841745.
The snippet above only handles basic algebraic simplification (math expressions without variables). Since the library converts LaTeX math to SymPy objects, the above code can easily be tweaked and extended to handle much more complicated LaTeX math (including solving derivatives, integrals, etc...).
The latex2sympy2 library can be installed via the pip command: pip install --user latex2sympy2
<>
try the AnEasyCalc program. It allows to get the latex formula very easy:
http://steamandwater.od.ua/AnEasyCalc/
:)