I'm trying to learn LaTeX. I've been googling this one for a couple days, but I don't speak enough LaTeX to be able to search for it effectively and what documentation I have found is either too simple or goes way over my head (http://www.uoregon.edu/~dspivak/files/multicol.pdf)
I have a document using the multicol package. (I'm actually using multicols* so that the first col fills before the second begins instead of trying to balance them, but I don't think that's relevant here.) The columns output nicely, but I want to be able to indicate that some content won't be broken up into different columns.
For instance,
aaaaaaaa bbbbbbb
aaaaaaaa bbbbbbb
aaaaaaaa
ccccccc
bbbbbbbb ccccccc
That poor attempt at ascii art columns is what's happening. I'd like to indicate that the b block is a whole unit that shouldn't be broken up into different columns. Since it doesn't fit under the a block, the entirety of the b block should be moved to the second column.
Should b be wrapped in something? Is there a block/float/section/box/minipage/paragraph structure I can use? Something specific to multicol? Alternatively is there a way that I can suggest a columnbreak? I'm thinking of something like \- that suggests a hyphenated line break if its convenient, but this would go between blocks.
Thanks!
Would putting the text inside a minipage not work for this?
\begin{minipage}{\columnwidth}
text etc
\end{minipage}
Forcing a column break is as easy as \columnbreak.
There are some gentler possibilities here.
If you decide to fight LaTeX algorithms to the bitter end, there is also this page on preventing page breaks. You can try the \samepage command, but as the page says, "it turns out to be surprisingly tricky".
Related
Here's my wild and whacky psuedo-code. Anyone know how to make this real?
Background:
This dynamic content comes from a ckeditor. And a lot of folks paste Microsoft Word content in it. No worries, if I just call the attribute untouched it loads pretty. But the catch is that I want it to be just 125 characters abbreviated. When I add truncation to it, then all of the Microsoft Word scripts start popping up. Then I added simple_format, and sanitize, and truncate, and even made my controller start spotting out specific variables that MS would make and gsub them out. But there's too many of them, and it seems like an awfully messy way to accomplish this. Thus so! Realizing that by itself, its clean. I thought, why not just slice it. However, the microsoft word text becomes blank but still holds its numbered position in the string. So I came up with this (probably awful) solution below.
It's in three steps.
When the text parses, it doesn't display any of the MSWord junk. But that text still holds a number position in a slice statement. So I want to use a regexp to find the first actual character.
Take that character and find out what its numbered position is in the total string.
Use a slice statement to cut it from.
def about_us_truncated
x = self.about_us.find.first(regExp representing first actual character)
x.charCount = y
self.about_us[y..125]
end
The only other idea i got, is a regex statement that allows it to explicitly slice only actual characters like so :
about_us([a-zA-Z][0..125]) , but that is definately not how it is written.
Here is some sample text of MS Word junk :
≪! [If Gte Mso 9]>≪Xml>≪Br /> ≪O:Office Document Settings>≪Br /> ≪O:Allow Png/>≪Br /> ≪/O:Off...
You haven't provided much information to go off of, but don't be too leery of trying to build this regex on your own before you seek help...
Take your sample text and paste it in Rubular in the test string area and start building your regex. It has a great quick reference at the bottom.
Stumbled across this
http://gist.github.com/139987
it looks like it requires the sanitize gem.
This is technically not a straight answer, but it seems like the best possible one you can find.
In order to prevent MS Word, you should be using CK Editor's built-in MS word sanitizer. This is because writing regex for it can be very complicated and you can very easily break tags in half and destroy your site with it.
What I did as a workaround, is I did a force paste as plain text in the CK Editor.
I am using LaTeX and I have a problem concerning string manipulation.
I want to have an operation applied to every character of a string, specifically
I want to replace every character "x" with "\discretionary{}{}{}x". I want to do
this because I have a long string (DNA) which I want to be able to separate at
any point without hyphenation.
Thus I would like to have a command called "myDNA" that will do this for me instead of
inserting manually \discretionary{}{}{} after every character.
Is this possible? I have looked around the web and there wasnt much helpful
information on this topic (at least not any I could understand) and I hoped
that you could help.
--edit
To clarify:
What I want to see in the finished document is something like this:
the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA
AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG
ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT
ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT
CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC
CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT
AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT
just plain linebreaks, without any hyphens. The DNA sequence will be one
long string without any spaces or anything but it can break at any point.
This is why my idea was to inesert a "\discretionary{}{}{}" after every
character, so that it can break at any point without inserting any hyphens.
This takes a string as an argument and calls \discretionary{}{}{} after each character. The input string stops at the first dollar sign, so you should not use that.
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\say{#1}\discretionary{}{}{}%
\takeTheRest#2\ofTheString
\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\say#1{#1}
You’d call it like \hyphenateWholeString{CTAAAGAAAACAGGACG}.
Instead of \discretionary{}{}{} you can also try \hspace{0pt}, if you like that more (and are in a latex environment). In order to align the right margin, I think you’d need to do some more fine tuning (but see below). The effect is of course minimised by using a font of fixed width.
Revision:
\def\hyphenateWholeString #1{\xHyphenate#1$\wholeString\unskip}
\def\xHyphenate#1#2\wholeString {\if#1$%
\else\transform{#1}%
\takeTheRest#2\ofTheString\fi}
\def\takeTheRest#1\ofTheString\fi
{\fi \xHyphenate#1\wholeString}
\def\transform#1{#1\hskip 0pt plus 1pt}
Steve’s suggestion of using \hskip sounds like a very good idea to me, so I made a few corrections. Note that I’ve renamed the \say macro and made it more useful in that it now actually does the transformation. (However, if you remove the \hskip from \transform, you’ll also need to remove the \unskip in the main macro definition.
Edit:
There is also the seqsplit package which seems to be made for printing DNA data or long numbers. They also bring a few options for nicer output, so maybe that is what you’re looking for…
Debilski's post is definitely a solid way to do it, although the \say is not necessary. Here's a shorter way that makes use of some LaTeX internal shortcuts (\#gobble and \#ifnextchar):
\makeatletter
\def\hyphenatestring#1{\xHyphen#te#1$\unskip}
\def\xHyphen#te{\#ifnextchar${\#gobble}{\sw#p{\hskip 0pt plus 1pt\xHyphen#te}}}
\def\sw#p#1#2{#2#1}
\makeatother
Note the use of \hskip 0pt plus 1pt instead of \discretionary - when I tried your example I ended up with a ragged margin because there's no stretchability. The \hskip adds some stretchable glue in between each character (and the \unskip afterwards cancels the extra one we added). Also note the LaTeX style convention that "end user" macros are all lowercase, while internal macros have an # in them somewhere so that users don't accidentally call them.
If you want to figure out how this works, \#gobble just eats whatever's in front of it (in this case the $, since that branch is only run when a $ is the next char). The main point is that \sw#p is only given one argument in the "else" branch, so it swaps that argument with the next char (that isn't a $). We could just as well have written \def\hyphenate#next#1{#1\hskip...\xHyphen#te} and put that with no args in the "else" branch, but (in my opinion) \sw#p is more general (and I'm surprised it's not in standard LaTeX already).
There is a contrib package on CTAN that deals with typesetting DNA sequences. It does a little more than just line-breaking, for example, it also supports colouring. I'm not sure if it is possible to get the output you are after though, and I have no experience in the DNA-sequence-typesetting area, but is one long string the most readable representation?
Assuming your string is the same, in your preamble, use the \newcommand{}{}. Like this:
\newcommand{\myDNA}{blah blah blah}
if that doesn't satisfy your requirements, I suggest:
2. Break the strings down to the smallest portion, then use the \newcommand and then call the new commands in sequence: \myDNA1 \myDNA2.
If that still doesn't work, you might want to look at writing a perl script to satisfy your string replacement needs.
IEEE conference publications in two-column format require authors to manually equalize the lengths of the columns on the last page of the final submission. I have typically done this by inserting a \newpage where necessary -- which usually ends up being somewhere amidst my (manually entered) references.
However, I have recently begun using BibTeX to manage references, and have now run into a problem: my last page contains only a few (generated) references, and I can't figure out how to manually equalize the columns.
The last page is the tail end of what is generated by:
\bibliographystyle{IEEEtran}
\bibliography{IEEEabrv,library}
Any ideas on how I can equalize the columns while continuing to use BibTeX?
I have submitted to both ACM and IEEE conferences and the easiest thing for me has been using:
\usepackage{flushend}
I've heard it doesn't always work well, but it's been great for me
http://www.ctan.org/pkg/flushend
I went back to RTFM again, and it turns out this is addressed right in "How to Use the IEEEtran LaTeX Class" by Michael Shell (maintainer). Section XIV notes that IEEEtran helpfully provides the \IEEEtriggeratref{} command for just this purpose. By default, it fires a \newline at the given BibTeX reference number. You can even change the command to fire with \IEEEtriggercmd{}.
It can also be done by using the balance package. You simply include the balance package in the preamble (\usepackage{balance}) and insert \balance some place on the last page of your document (for instance right in front of the references). However, I'm not sure if it's working if the last page (both columns) is completely full of references...
IEEE requires authors to equalize the lengths of the columns on the last page.
ACM makes us do this too. I just wind up inserting \vfill\break by hand either in the main text or somewhere in the .bbl file, wherever it makes the columns balance. By the time camera-ready copy goes to ACM, they want the .bbl file inlined by hand anyway, so tinkering by hand does not present an additional hardship.
The reference-number trick might be nice except I never use numbered references :-)
The multicols environment works only if you're luck and your last page comes out exactly as bibliography.
It would be extremely good (and not so difficult) if some enterprising hacker would build the "balance the two columns in the last page" functionality straight into LateX's \output routine. The flexibility is there in the underlying engine, and it would make a lot of people happy.
Not sure if multicol conflicts with bibtex at all, and I don't have time to check, sorry. But try this:
use the multicol package:
\usepackage{multicol} in your preamble, then:
\begin{multicols}{2}
\bibliographystyle{IEEEtran}
\bibliography{IEEEabrv,library}
\end{multicols}
Multicol automatically balances columns. I would recomend using it through out your document, instead of using the .cls or .sty's twocolumn option.
I have a section:
\section{Introduction} \label{sec:introduction}
I'd like a link to the section where the link text is the name of the section. I can use hyperref:
The \hyperrf[sec:introduction]{Introduction} introduces the paper.
But that requires repeating the section title ("Introduction"). Is there a way to grab that? ref yields the section number, which isn't right. autoref yields "section " and then the section number, which isn't right, either.
There are a couple of packages that provide this for you. nameref is distributed as part of hyperref to do this:
http://tug.ctan.org/cgi-bin/ctanPackageInformation.py?id=nameref
There is a more general package for cross-referencing basically anything, called zref:
http://tug.ctan.org/cgi-bin/ctanPackageInformation.py?id=zref
It's by the same author as hyperref, Heiko Oberdiek; it's the one that I would choose. Here's an example:
\documentclass[oneside,12pt]{article}
\usepackage[user,titleref]{zref}
\begin{document}
\section{Introduction of sorts.}\zlabel{sec:intro}
Hello
\subsection{Structure}
We begin in `\ztitleref{sec:intro}'.
\end{document}
Note that it even removes the trailing period in the section title.
As far as I know, there's no standard way to do this. Simply put, the sectioning commands don't store the names of the sections anywhere they can be easily retrieved. Yes, they're inserted into the Table of Contents (and associated auxiliary file) and marks are set, but access to those is unreliable at best and usually impossible without additional context, which is almost always unavailable by the time you need to refer back to the section.
The code sample you posted looks like what I would write. There might be a package to automate this, but if one exists it's probably pretty hairy code since this is really not a particularly common use case. Actually, to go all grammar nazi on you the final text you're creating is incorrect; the word "introduction" should be lowercase inside the sentence, and this can't be achieved (in general) with backreferences to the actual section titles.
I'd just suck it up and write out references like this manually. There won't be enough of them to justify automation. Of course, if you're doing something more involved than your example suggests (many auto-generated sections or something) things might be different, but if that's the case it's really a different question entirely.
You could try using
\newsavebox
\savebox
\usebox
which won't save you any typeing but will give you a single authoritative source for each title
And you might search ctan.org, I suspect this has been done already.
I am using LaTeX and in some cases have multiline footnotes.
When I use a two-column format and especially when the reference to a footnote is low in the column, LaTeX will often split the footnote in half: it starts in the original column, but then continues under another column (sometimes in another page), which is very distracting.
Is there a way to force LaTeX to never split footnotes and allocate enough space for them?
Use \interfootnotelinepenalty=10000 to totally disallow this. But be prepared for other layout artifacts... Setting the penalty lower than 10000 will give TeX some flexibility in deciding when the side effects are too bad to bear.
For a detailed discussion see the TeX FAQ item Why does LaTeX split footnotes across pages?
I've found that it's best to get the style sheet from where you're trying to publish, and just use their format (I'm assuming you're trying to publish somewhere, if you're using a double-column format). The editors can then handle wacky footnoting. If it's for a thesis, I don't know about your committee, but mine has told me that a single column, double-spaced is the way to go, which should avoid your problem in the first place.